Seroprevalence, Isolation and Molecular Detection of Infectious Bronchitis in Backyard and Commercial Chickens in Central Gondar Zone, Northern Ethiopia

Background of the Study

The total chicken population in Ethiopia is estimated to be 56.5 million. However, the economic contribution of the sector is not still proportional to the huge chicken numbers, attributed to the presence of many productions, reproduction and infrastructural constraints. Diseases and predators are known to be the major causes of losses in the country. Newcastle disease accounted for the largest proportion of overall flock mortality to be 57.3% followed by fowl pox 31.6%, coccidiosis, 9.4% and predator loss 1.7% [1].

Infectious bronchitis virus causes acute highly contagious viral disease of chicken known as infectious bronchitis, which is characterized by lesions in the reproductive, urogenital, and respiratory organs [2].

Chickens of all ages can contract the disease, although young chickens are more vulnerable because resistance builds of with age. Due to poor performance, lower egg output and quality, and mortality that can be severe in the presence of nephropathogenic strains or when secondary infections emerge, the condition generates significant economic losses in the chicken industry following avian influenza; it is believed that IBV infection causes the third- highest losses among all livestock diseases [3].

The virus is a member of the Coronaviridae family and its 27.6 kb single-stranded positive sense RNA genome has the following genomic arrangement and: fifty untranslated regions 30UTR: 1a/1ab S 3a 3b E M 5a 5b. While the non- structural viral proteins are encoded by two polyproteins, the structural viral proteins include the membrane (M), small membrane (E), nucleoprotein (N), and spike (S).The spike protein, among others, is the subject of extensive research due to its genetic diversity and biological function [4].

Following the discovery of the first IBV serotype in USA in 1931, the virus was detected in other US states, and a large variety of IBV genotypes and serotypes were described globally [5]. Infectious bronchitis is still a problem for the poultry industry despite global attempts to manage it thus far, mostly because of IBV’s large genetic diversity, rapid generation time, and high mutation rate. The effectiveness of natural or vaccination immunity is hampered by the ongoing emergence of genetic diversity and the selection process among IBV variants [6].

In Africa, IBV is one of the most important viral diseases that threaten chicken production. It was first reported in Africa in 1950 in Egypt from birds with respiratory symptoms. The disease is the most prevalent viral respiratory infections of chickens in the continent and is widespread in both vaccinated and unvaccinated poultry birds and is regarded as an epidemic virus [7]. The disease is common in Ethiopia though its prevalence and type of strains has not been well studied in the present study area [8].

Objectives of the Study

General objectives: This study is aimed at determining the seroprevalence of infectious bronchitis virus antibody and to detect infectious bronchitis virus antigen of poultry in central Gondar zone. Specific objectives: To determine the seroprevalence of infectious bronchitis in chickens within the study area

• To isolate and detect infectious bronchitis virus in poultry in the study area
• To study some associated risk factors

Statement of the Problem

Infectious bronchitis is one of the most serious viral infections threatening chicken farming in Africa. Despite reports of respiratory disorders in chicken from all production systems in Ethiopia, there is a paucity of reports on infectious bronchitis (IB). Accordingly, there is only one report about IB seroprevalence which indicates a seroprevalence of 24.6% [9] and no published evidence on molecular detection of the virus in northern Ethiopia in general and the study area in particular. Furthermore, the disease is a poorly studied condition in Ethiopia since it is frequently masked by other infections such as Newcastle disease and other respiratory diseases.

Research Questions

• What is the seroprevalence status of infectious bronchitis in the study area?
• What are the associated risk factors for the occurrence of infectious bronchitis?
• Is infectious bronchitis virus circulating in the study area?

Justification of the Study

Chickens in Ethiopia are not vaccinated against infectious bronchitis especially in rural areas where birds are mostly managed semi-intensively with little or no veterinary care and are left to search for food for most of the day. This practice promotes the rapid spread of the disease. Although

there are some published evidences on the sero-prevalence of the disease with variable figures across the country, there is a limited information on the seroprevalence and there is no information on molecular detection of the virus in both commercial and rural scavenging poultry in Central Gondar Zone. In order to prevent and control the disease by implementing vaccination and biosecurity measures, it is essential to identify the occurrence of the disease in the study area. Therefore; the present study was performed to determine the prevalence of the disease and to detect the existence of infectious bronchitis virus circulating in the study area.

Ethical Approval

Ethical clearance was obtained from the Ethics Committee of the National Veterinary Institute of Ethiopia. Accordingly, handling of the study animals throughout the study period was done based on the guideline of the institute. The poultry owners provided their permission and authorization for the collection of the samples.

The Study Area

Amhara Regional State is one of the largest state in Ethiopia with a large poultry population. The Central Gondar zone is located in the Amhara National Regional State, and its principal city, Gondar, is 727 kilometers from Ethiopia the capital, Addis Ababa (Figure 1). Geographically, the area lies between 12.3° and 13.38° N latitudes and 35.5° and 38.3° E longitudes. Central Gondar zone is located between 528 and 4620 meters above sea level. The average annual rainfall ranges from 880 mm to 1772 mm, with a monomodal distribution and temperatures ranging from 10°C to 44.5°C [9]. The overall population of central Gondar Zone is 2,642,114, with 2,204,225 (88.66 percent) living in rural villages that rely on agriculture for their livelihood. As a result, the study region is a significant source of livestock that contributes to the country’s growth and domestic production. This area houses around 737,713 sheep, 1,479,366 goats, 3,234,012 cattle, 392,546 donkeys, 12,252 mules, 39,178 horses, and 3,310,498 chickens [10].

Click to enlarge

Cross-sectional study design was used in this study. For district selection; a simple random sampling was utilized as a sampling strategy. A simple random sampling technique was also used to select poultry farms and individual chickens. Before blood and tracheal swab samples were taken, potential risk factors such as flock history (age, purpose of production, sex, breed, and method of production) and vaccination history in general were noted.

Study Animals

Because maternal antibodies are expected to diminish within three weeks of life, chickens were sampled when

Sample Size Calculation

The sample size for the study was calculated using Thrusfield’s formula [11], with a 95% confidence interval of 5% desired absolute precision and a prevalence of 24.61% from previous studies. Thus, 285 chickens were required for this study. However, to improve the precision of the study the sample size was expanded to 384.

( ) 2 exp exp

2 1.96 P 1 P N d − =

Where N= required sample size, Pexp= expected prevalence d2 =desired absolute precision. z=1.96, p=0.5 and d=0.05

Blood Sample Collection

Two to three ml blood sample was collected from unvaccinated chickens in different farms from the wing vein. To clot the blood, the collection tubes were kept slant for 24 hours at room temperature. Then sera were collected and placed into 2ml tubes and frozen at 20°C until they were processed at National Veterinary Institute of Ethiopia.

Swab Sample Collection and Preparation

Fifty two chickens that appeared to be diseased in total were chosen at random to have tracheal swab samples prepared for PCR analysis. Each swab was placed in a PBS (Phosphate Buffer Saline) containing antibiotic filled sterile tube and transported under cold chain and kept at –20°C in University of Gondar Veterinary Microbiology Laboratory. Then the samples were transported to the National Veterinary Institute of Ethiopia for processing under cold chain and kept under –80°C until processed. Then the samples were taken out from –80°C and thawed for a few minutes. Then in order to make it easier to remove the contents from the swab head, the swab samples from each flock were vortexed and samples from the same farm were pooled into one that makes a total of 26 samples which were then made ready for injection in to specific pathogen-free (SPF) eggs.

Virus Isolation

Specific pathogen-free (SPF) embryonic eggs were used in the viral isolation process. 0.2-0.3 ml of sample supernatant was inoculated into the allantoic cavities of 11day old embryos and no sample were inoculated in to the controls. Eggs were candled every day for four days with mortality occurring within the first 24 hours being regarded as nonspecific. After 96 hours of infection, all of the eggs allantoic fluids were collected and used to infect another egg groups up to three passages. Embryonic deaths after 24 hours of infection were observed and recorded. Infective allantoic fluids were collected from the third passage and kept at –20°C and processed by RT-PCR for molecular detection.

Serological Analysis

According to the manufacturer’s recommendations, an indirect ELISA (ID Screen® Infectious Bronchitis Virus Indirect) was performed to detect antibodies against IBV in chicken serum. The test is designed to detect IBV specific antibodies that are conserved across serotypes, allowing all IBV types to be detected. Four 96-well plates (precoated with purified viral antigen), positive and negative IBV antibody control sera, concentrated conjugate (10 xs), dilution buffer 14, dilution buffer 3, washing buffer (20 x), substrate solution, and stop solution were used in the test in accordance with the manufacturer’s instructions. The microplates were examined using an ELISA micro plate reader at a wavelength of 450 nm. The ELISA sample to positive ratio for each serum determined the interpretation of the data. The percentage of positive sera among the total number of examined sera was used to calculate IBV prevalence.

The unknown test samples were evaluated Parallel to positive and negative controls,. Using a precoated ELISA plate and ready-to-use reagents, all conditions were standardized according to kit manufacturer specifications. The test was valid if the mean OD value of the positive control was greater than 0.250 and when the ratio of the positive and negative control mean values is greater than 3. The ELISA sample-to- positive (S/P) ratio for each serum was used to evaluate the results. Serum samples with an S/P value greater than 0.2 were considered positive.

S Pratio ODsample OD NC ODPC OD NC = − −

Where S/P is the sample to positive ratio; OD is the optical density; ODNC is the optical density of negative control; and ODPC is the optical density of positive control.

RNA Extraction

RNA was isolated by using the Qiagen RNeasy Mini Kit protocol. Based on the this protocol 350µl of RLT lysis buffer was added to 350 µl sample aliquots to bring them to room temperature, and were mixed by pipetting. Next, 350 µl of 70% ethanol was added, and they were again mixed by pipetting. The sample mixture was then poured into an RNeasy spin column and centrifuged for 30 seconds at 13000 rpm. The flow through liquid was then discarded. After centrifuging RNeasy spin column for 30 seconds at 13000 rpm with 700 µl of buffer RW1, flow through liquid was discarded. Then 500 µl of RPE buffer was added in to RNeasy spin column and centrifuged at 13000 rpm for 2 minutes. After discarding the liquid flow, the column was put in a fresh 2 ml tube and centrifuged for 1 minute at 13000 rpm. The column was then put into a fresh 1.5 ml tube. Following the addition of 40 µl of RNAse-free water, the column’s membrane was centrifuged at 13000 rpm for one minute. The water containing RNA was then removed from the tube in an effort to recover as much of it as feasible. The membrane was then re-added to, and it was centrifuged for 2 minutes at 13000 rpm. To keep the RNA until usage, the tube was finally closed.

RT-PCR Analysis

A standard One Step RT PCR Kit was used to test the pools for the presence of IBV by amplifying 466 bp hypervariable region of the S1 gene. Briefly,1X reaction mix, 2μl of forward primer 5’ XCE1(CACTGGTAATTTTTCAGATGG)3’ and 2 µl of reverse primer 3’XCE2 (CCTCTATAAACACCCTTGCA)5’, primer pair, and one step RT PCR 1μl enzyme mix were combined with 5μl of isolated RNA. 5x -Q solution 5 μl, 5x -RT PCR buffer in 5μl, 1μl of 10- mM dNTPs mix, and then 4 μl of RNA-free water were added to make a total volume of 25μl. The thermal protocol that was chosen went as follows: 50°C for 30 min, 95°C for 15 min, 1 cycle, followed by 94°C for 30 sec, 55°C for 1 min, and 72°C for 1 min for 35 cycles. A final extension step lasting five minutes at 72oC was also carried out. Then 1.5 percent agarose gel was used to mix 3 grams of agarose and 200 ml of 1xTAE buffer and kept for two minutes in the microwave then take out of the microwave for cooling. After cooling down to room temperature for 5 minutes, 4 µl of Gel Red was added in to the gel and left for 20 minutes. Then 10 µl PCR product that had 4µl of loading dye added to it was then loaded into each well along with a negative control and a positive control. Finally, 10µl of a molecular marker (ladder) starting at 100 bp was added. After that, electrophoresis was carried out for 1:20 hours at 120 volts, and the result was read under UV light. IBV results that are positive display 466 bp.

Data Analysis

The data collected from field level and laboratory investigation was coded into appropriate variable and entered in to a Microsoft Office Excel spreadsheet. The data was checked for errors entry, coded and then imported to SPSS for descriptive and further analyses. All statistical analyses were performed using SPSS version 26 software. Binary logistic regression was used to study associated risk factors.

Serological Result with Associated Risk Factors

Indirect ELISA test was used to test serum samples from chickens in Gondar city and three districts in northwest Ethiopia for previous exposure to infectious bronchitis virus. 354 of the 384 blood sera tested for infectious bronchitis virus antibodies were positive. The prevalence of IB was found to be 92.19% (89%-94.6% with 95 CI %). Table 1 shows IB seroprevalence in Gondar city and three districts; with no significant difference between them (p > 0.05) .The prevalence of the disease was found to be 96.66% in west Dembya, 90.82% in East Dembya, and 85.39% in Gondar Zuria. A significantly higher prevalence was discovered in young chickens (95.83%) compared to adults (87.5%) with COR 3.286 (95 % CI 1.463-7.378) (p<0.05). The prevalence of IB was also higher in exotic breeds (94.57%) with COR 3.903(95 % CI 1.798-8.471) than local breeds (81.69 %) with a significant difference (P <0.05). The prevalence in females (92.7%) was higher than males (90.98 %) with COR 1.267(95 % CI 0.583-2.753) but the difference was not significant (p>0.05). Though the difference was not statistically significant (p>0.05) the prevalence in intensive farms was higher (93.39%) than the prevalence in extensive farms (90.69%) with COR 1.451(95 % CI.687-3.063). Higher Seroprevalence (93.75%) was observed in dual purpose chickens followed by layers with a prevalence of (92.7%) and broilers (90.98%) but the difference was not statistically significant (p>0.05) (Table 2).

COR: crude odds ratio; 95% CI: 95% confidence interval. P values <0.05 were statistically significant. Table 1: Univariable Logistic Regression Analysis Result in Relation with Study Area.

COR: crude odds ratio; AOR: adjusted odds ratio; 95% CI: 95% confidence interval. P values <0.05 were statistically significant. Table 2: Univariable and Multivariable Logistic Regression Analysis Result in Relation with Associated Risk Factors.

RT-PCR Result

Samples that were injected in to SPF eggs were collected after 96 hours and passaged three times and were taken in to molecular biology laboratory for PCR analysis. The test was performed following the standard protocol. Among the

26 pooled samples tested 3 (11.54%) of them were positive during RT-PCR examination. Amplification of an expected DNA band (466 bp) from positive control as well as IBV positive swab samples indicated that the RT-PCR reaction has been performed correctly (Figure 2).

Click to enlarge