Beta Fulltext view is in preview — article structure may vary. Browse all articles
Contents
Bioinformatics & Proteomics Open Access Journal Research Article 18 min read

Perfect and Imperfect Microsatellite Markers in Determination of Genetic Status of Greater Adjutant Stork (Leptoptilos dubius Gmelin)

Sharma DK*, Baruah C and Barman PD
* Corresponding author
ISSN: 2642-6129  10.23880/bpoj-16000137  Received: May 07, 2021  Published: June 30, 2021
  views
 76 references
 4 tables
PDF
Keywords
Perfect Imperfect Iterations Microsatellite Polymorphism Genetic Status Greater Adjutant Leptoptilos dubius (Gmelin)
Abstract

The Greater Adjutant Stork (Leptoptilos dubius), the most endangered stork (IUCN Red List criteria under A2bcd+3bcd+4bcd; C2a) losing its number by population has been confined in a small village named Dadra- Pacharia- Singimari in the district of Kamrup, Assam, India. An attempt was made to study the status of genetic variability in Greater Adjutant Stork revealed that though the Greater Adjutant Stork population is highly threatened, yet the group has been appeared as genetically stable as recorded from that of the observed heterozygosity. Therefore, it is of importance to study the distribution enrichment and polymorphism of microsatellites in the genome of the Greater Adjutant Stork. Five microsatellite markers of cross speciesspecific markers were deployed in this study. All the five microsatellite markers were recorded to be polymorphic with the number of alleles varying between 2 to 9 across all loci used. The locus Ah341 was observed to have 2 alleles whilst the locus Cc07 was with 9 alleles. The heterozygosity of L. dubius was observed to be high for the microsatellite markers used, with mean observed heterozygosity (Ho) of 0.752±0.09 and mean expected heterozygosity (He) was with 0.677±0.06. The overall mean expected heterozygosity was found to be marginally higher than the observed heterozygosity. The polymorphic interaction count (PIC) was calculated at 0.569±0.03. Iteration value in the consensus sequence recorded for dinucleotide (TG) was dominating at 20 followed by mononucleotide (A) at 12, while the percent (%) of Imperfect iteration stood at the highest of 14.8%. Thus, the result of this investigation has extended a clear genetic polymorphism in favour of the Greater Adjutant stork, perhaps yet to face any genetic threat.

Introduction

The Greater Adjutant Stork Leptoptilos dubius, an endangered recognized as declining species in number as per the IUCN Red List criteria under A2bcd+3bcd+4bcd; C2a [1, 2, 3] and the species is in the verse of extinction. The species Greater Adjutant stork was once very widely distributed in India, South and South East Asia, but currently available only in Assam and Bihar in India [4, 5, 6, 7, 8, 9, 10] and a very few in South East Asian countries [1, 11, 12]. Of the total estimated global population of about 1000-1200 birds [13], about 800 birds have been found in Assam, considered to be the global stronghold of this stork. According to Luthin [1] South Asia has been endowed with the richest diversity of storks and of the twenty species of storks, eleven are found in South East Asia among which eight species are reported from India [1, 14]. Seven species of storks are found in Assam [15, 16] of which the Greater Adjutant is an endangered species. The Dadara-Pacharia-Singimari village area in the Kamrup District of Assam, India holds the highest number of Greater Adjutant and is located just 10 km away from the city of Guwahati, Assam, India [17, 18]. According to ICBP/IWRB Storks, ibises and spoonbill group including the Greater Adjutant Leptoptilos dubius has been adjudged as the systematically disappeared bird species throughout its early distribution ranges and this might be the possible reasons to attract this species as the most threatened one with the extinction possibilities, needs special attention [1, 18, 19]. Information related to its taxonomy, morphology and to a certain degree of ecological approaches are available [20, 21, 22, 23, 24, 25], yet without with any genetic information. Since this species exhibits no migratory behaviour and tends to use the colonial sites over the years like that of wood stork Mycteria americana [26], generally response to the seasonal fluctuation like its attempt for pairing and colony formation in the same locality of their nesting sites [27].

So far, no approach has been made to investigate on the genetic variability in Greater adjutant, which could perhaps be able to determine its position with the help of molecular markers like microsatellites. Microsatellites or simple sequence repeats (SSR) are the nucleotide tandem repeats of short sequence motif of 1-6 base pairs [28], distributed both in coding and non-coding regions of DNA [29, 30]. Microsatellites are the regions of DNA that contain di, tri or tetra nucleotide repeats. They are randomly distributed across the genome of most species [31, 32]. Because of their high degree of polymorphic nature, they are extensively used in studies related to evolution of genetic status of species [33]. Increase or decrease of repeat base number in microsatellite in the coding region often changes the protein product [29, 34], and in the noncoding regions leading to the mutations [35]. They are concomitant and highly polymorphic markers [36] carries high increases the mutation rate like 10-2 to 10-6 per meiotic cycle [37]. Because of their high polymorphism, they are extensively used in studies related to evolution of genetic status of a species [33]. Due to its higher rate of mutability the microsatellite has been placed on record as the source of genetic diversity of a species [38]. The categories of microsatellites, the imperfect and perfect repeats states that the former one is more stable compared to the later [39, 40]. And the application of bioinformatics tool gives the opportunity to identify the perfect and imperfect mutation [41].

It has already been accepted that except for repeat copy number variation, a microsatellite (e.g.,  ATATATATAT) also suffers from nucleotide substitutions and insertion/deletion mutations, attains the status of imperfect (e.g., ATATATCATAT: AT repeat with an insertion of C and the genomes possess a relatively small but significant number of imperfect microsatellites [42]. Imperfect microsatellites is critical for their maintenance in the genome [43] due to mismatch variation being less prone to slippage mutation, allows the imperfect microsatellites to be more stable compared to perfect microsatellite [40]. Yet, the level of understanding of motif mismatches in imperfect microsatellites is still extremely limited and their correlation with life aspects demands critical evaluation.

Lack of species-specific microsatellite markers, perhaps be one of the reason for no genetic variability investigation, yet certain attempts were made on the genetic variability using microsatellite markers in other birds [44, 45] like oriental population of white stork [46], European white stork [47], white faced Ibis [48], Painted stork [49], Wood stork [50] and in Asian woolly necked stork [51]. Thus, the rapid decline of the Greater adjutant has drawn wider attention to this background. Hence, the aim of the present study was to analyse perfect and imperfect microsatellite markers for determination of genetic status of Greater Adjutant Stork (Leptoptilos dubius Gmelin). The objectives were to

  • Examine the levels of genetic diversity,
  • Inbreeding status, and
  • Population differentiation in breeding colonies of Leptoptilos dubius.

This study reports on the five new microsatellite markers developed for L.dubius that have been compiled in a series of PCR with six markers previously described for white stork Ciconia ciconia and white heron Ardea herodias [47, 52]. Hence the goal of the present study was to examine the levels of genetic diversity, inbreeding and population differentiation in breeding colonies, which could perhaps be able to suggest a benchmark information to formulate a conservation action plan.

Materials and Methods

Sampling

Samples for the present work had been collected from the dead specimens of Greater adjutant either from adult or from the chickens at certain wetlands and from the lone garbage site of the capital city of Guwahati in the Kamrup District of Assam situated between 25°43/ and 26°51/ N Latitudes and 90°12/ and 90°36/ E Longitudes (Table 1). A total of 23 tissue samples were opportunistically collected following the procedure of Huang and Zhou [53]. In brief 0.2 g of dead tissues (for each sample) was placed in 2mL of centrifuge tube to which 500 µL of the following solution was added comprising of 10 mmol-L-1, Tris-HCl, 100 mmol-L-1 EDTA, 150 mmol-L-1 NaCl and 0.8% SDS followed by the addition of K 40 µg.mL proteases. A veterinarian from the College of Veterinary Science, Guwahati, India collected the tissue samples, kept in 95% ethanol and stored at -20°C till the extraction of DNA.

Wetlands and other foraging sitesGPS point
1Digheli Beel, Dadara26°14′17.87″N/91°39′17.92″E
2Bhoka Beel, Dadara26°13′26.51″N/91°38′31.06″E
3Pondoba Beel, Dadara26°13′25.55″N/91°38′41.05″E
4Singimari, Dadara26°13′11.69″N/91°38′36.36″E
5Deepar Beel, Guwahati26°06′53.01″N/09°40′49.62″E
6Jeng Beel,North Guwahati26°16′45.30″N/91°46′33.40″E
7Garbage Dump, Boragaon26°06′53.01″N/91°40′49.62″E

Table 1: GPS coordinates of foraging wetlands and sample collection sites for Greater Adjutant Stork.

Extraction of DNA and Selection of Marker

DNA isolation was carried out using modified Phenol- Chloroform method [54]. The Genetic status of L. dubius was attempted to be evaluated by using microsatellite markers and no microsatellite markers have been developed from L. dubius so far. Development of microsatellite markers requires substantial input of time as well as expertise.

on the use of existing microsatellite markers on species for which they were not originally designed [55]. Therefore, in the present study cross-species amplification of six highly polymorphic microsatellite markers comprising of three markers originally developed from White stork [47] and other 3 markers originally developed from Great blue heron [52] were initially tested to assess the possibility of their use to ascertain the genetic marker for L. dubius. The details of the markers used are given in the Table 2.

  • For this reason, considerable effort was given in general
  • Sl.No.
  • Locus
  • Primer Sequence (5’-3’)
  • TA (⁰C)
  • Developed From
  • 1
  • Cc01
  • F: TTCTTGCATTTGCTCCAGTG
  • 55
  • Ciconia ciconia
  • R: CACAAACATCAGCAAGGACAG
  • 2
  • Cc06
  • F: CTCGCTGTCTCCTCTGCTCT
  • 55
  • Ciconia ciconia
  • R: GAACAGCAATATCGCATCTACA
  • 3
  • Cc07
  • F: GCATGAAAATGCATAGAGCAGA
  • 55
  • Ciconia ciconia
  • R: CCACCGTTATGATCCTTTGG
  • 4
  • Ah211
  • F: GCTCATCAGGAGTTGAATCTGGC
  • 55
  • Ardea herodias
  • R: TCTGTCATTCAGCAATGGACC
  • 5
  • Ah341
  • F: GGTAATGATTCTGATTTACCACTGAGGG
  • 55
  • Ardea herodias
  • R: ATGTGTTATCATATCTGGTCTTCACAGC
  • 6
  • Ah343
  • F: CATTGCTTAACTTCTGAAGAAAC
  • 55
  • Ardea herodias
  • R: CTTGACCCAGCATTTGTGAATAAAACTG

Table 2: PCR primers used for amplification of microsatellite loci of Greater adjutant Stork.

Amplification of Microsatellite Markers

All the Polymerase Chain Reactions (PCR) were set for a reaction volume of 25µl composed of 100ng of a DNA template, 0.4 µmol. L-1 per primer, 1.5 m.mol. L-1 MgCl2, 0.2mmol. L-1 DNTP and 0.8 U Taq Pol [53]. The PCR was allowed to proceed on a Bio-Rad thermal cycler. The settings were as follows that the products were pre- degenerated at 95°C for 15 min, denatured at 94°C for 30 s, annealed at 50 -55°C for 80 sec, extended at 72°C for 60s and after 40 cycles the products were extended at 72°C for 10 min. The reaction was allowed to terminate at 4°C. The PCR product had been detected by 1% agarose Ethidium bromide (EB) gel electrophoresis and the effective primers were selected. The PCR products were gel purified and sequenced for both forward and reverse direction using an ABI PRISM® 3100 Genetic Analyser and the allele sizes were determined using GENEMAPPER version 4.0 (Applied Biosystems) and 500- LIZ as size standard. The sequences generated were then compared with NCBI GenBank database using programme BLASTN [56] and were deposited in the GenBank.

Verification of Amplified PCR Products and Genetic Analysis

The genetic status of L. dubius was evaluated in terms of observed heterozygosity (Ho) and expected heterozygosity (He).The estimates of Ho and He were obtained using population genetics software package Excel Microsatellite Toolkit 3.1.1 (http://animalgenomics.ucd.ie/sdepark/ mstoolkit/). And this tool generates perfect and imperfect repeats [57] as well as the differential distribution of repeats [58]. Deviations from the Hardy-Weinberg Equilibrium were tested using Chi-square test. The nucleotide counts, A-T and G-C content as well as individual nucleotide frequencies for all the sequences generated were further estimated.

In Silico Microsatellite Analysis

The microsatellites were obtained using the bioinformatics software tool IMEx (Imperfect Microsatellite Extractor) followed after Mudunuri and Nagarajaram [59]. IMEx uses simple string-matching algorithm with sliding window approach to screen DNA sequences for microsatellites and reports the motif, copy number, genomic location, nearby genes, mutational events and many other features useful for in-depth studies. The percentage of mutation was calculated as: Percent (%) = number of point mutation in the observed tract X100 / Total number of bases in the equivalent perfect tract.

Parameters Used For Repeat Types

  • Imperfect: Imperfection was counted at 10% for Mono, Di, Tri, Tetra, Penta and Hexa repeats. Mismatches allowed in Pattern are for Mono: 1, Di: 1, Tri: 1, Tetra: 1, Penta: 2, Hexa: 2;
  • Minimum No. of Repeat Units: Mono: 5, Di: 3, Tri: 2, Tetra: 2, Penta: 2, Hexa: 2

Results and Discussion

Evaluation of Genetic Status: All the five microsatellite markers were recorded to be polymorphic with the number of alleles varying between 2 to 9 across all the loci used (Table 3). The locus Ah341 was observed to have 2 alleles, while the locus Cc07 presented 9 alleles. The mean observed Heterozygosity (Ho) 0.752±0.09 and the mean expected Heterozygosity (He) 0.677±0.06 has been depicted in the Table 3. The test of Hardy-Weinberg Equilibrium (HWE) presented 3 out of the 5 microsatellite loci namely Cc01, Cc06, Cc07 and Ah341 deviated from the HWE.

LocusRepeat MotifAllele SizeNaH
e
H
o
PICP%
Cc01(TTCT)
10
161-25960.8420.7610.5340.0467*55
Cc06(TG)
13
201-26250.6380.8540.6530.0312*60
Cc07(AAAG)
10
273-29090.6130.3470.4560.0212*75
Ah211(CA)
13
100-11440.8450.7920.5740.1217**21
Ah341(AC)
12
182-20720.8130.6310.6550.0342*61
Mean5.20.752±0.090.677±0.060.574±0.03

Table 3: The test of Hardy-Weinberg Equilibrium (HWE) presented 3 out of the 5 microsatellite loci namely Cc01, Cc06, Cc07 and Ah

Table 3: Characterization of polymorphism in five Microsatellite loci of Greater Adjutant Stork. Na= Number of alleles; He = Expected heterozygosity; Ho= Observed heterozygosity; PIC = Polymorphism information count; P= probabilities of Hardy-Weinberg Equilibrium Test (HWE); P=<0.05 indicates significant deviation from that of HWE test. ‘*’ = Significantly different.

Microsatellites amplified with specific primers (12 sequences out of 23 samples) have been depicted in the Table 4, with iteration and probable mutation (P %). The sequence KY 5252(67, 68, 69, 70, 71, 72 and 78) showed for imperfect iteration (P %) in between 3-15%. The total number of base pairs was 2918 (Table 4).

The present analysis on the status of the genetic polymorphism in Greater Adjutant Stork revealed that the population has been qualified to be threatened despite of being genetically stable in terms of heterozygosity. All the microsatellite markers had well been recorded as polymorphic with the number of alleles varying in between 2-9 in all the loci used so far. The loci Ah341 had been observed to have the lowest number of alleles, whilst the locus Cc07 was recorded for 9 alleles (Table 3). The heterozygosity of the L. dubius might be high for the microsatellite markers as used in the present study with the mean value recorded against observed heterozygosity (Ho) at 0.752 ±0. 09. The sequences have been found to be identical in nature with that of Ciconia boyciana [53]. The expected heterozygosity (He) is the probability that two alleles chosen at random from a population are different [60] and proportionate representation of a sample is the observed Heterozygosity (Ho) [61]. Therefore, these two definitions of mean gene diversity could well be regarded as a measure of genetic variability which might be significantly informative in nature. The use of microsatellite in establishing the polymorphic character and genetic variability has already been well accepted [62] and favours the present observations on L dubius.

The Greater adjutant occupies a significant role in the wetland ecosystem and being carnivorous, occupies the top position [63]. The loci Cc01, Cc06, Cc07 and Ah 341 have been able to present a significant mean value of (0.677) in terms of the observed heterozygocity (Table 3). Thus, all the values obtained in terms of the characterization of the polymorphism in L. dubious have been able to substantiate that the species still out of danger regarding its genetic status viability. Thus, in a given species, microsatellite markers could well be isolated and developed from scratch using methods such as magnetic beads [64] or by applying cross-species amplification using existing markers from closely related species [65, 66]. This small group of Greater Adjutants usually might have a high degree of relatedness which showed even a marginal deviation from that of HWE. Therefore, it is speculated that the number of loci deviating from the HWE might be evident that these individuals are not the single breeding population group, possibly represent for many from different range within their distributional jurisdiction. The mean observed heterozygosity of the present study might be within the similar range with that of another stork group like Painted stork Mycteria leucocephala [49]. Recent studies on the genetic diversity of Asian woolly necked stork (Ciconia episcopus) in 66 individuals of population structure in captivity (Nakhon Ratchima Zoo, NRZ) using 13 microsatellite loci, allowed to infer that the deleterious genetic issues had been resulted out of captivity [51], though such experimentation and evaluation had not been possible for the Greater adjutant. However, the present study for the first time extended the idea of genetic polymorphism and favours the proposition that the Greater adjutant is yet to face any genetic threat. Further, it has well been argued for the heterozygote instability (HI) hypothesis, that it locally increases the mutation rate and there has been the occurrences of rare allele AC sequence of microsatellite [67], since the tandem repeats [68] suggest the HI potentially increases the mutation rate of heterozygous site itself.

The polymorphic information count (PIC) values encountered to the microsatellite loci studied from 0.455 to 0.655 with a mean value of 0.577 (Table 3) might be suggestive of allele medium number carries a considerable degree of genetic variability could well be supported by the work of Fonteque and colleagues [62]. It was of the opinion that when the PIC of the gene locus is greater than >0.5 has been considered as the high degree of polymorphism, while the PIC in between 0.25 to 0.5 the gene locus is moderate against the low value while it is at <0.25. In the present experiment the PIC stands at its lowest level at 0.455 for Cc07 while the highest had been obtained against Cc06 at 0.653 (Table 4) favoured high degree of genetic variability as mentioned in earlier works [53, 69].

Tandem repeats recorded in this study for 12 microsatellite sequences are found to its maximum for the GenBank sequence Ky515273.1 at 14.8% for GAAA with imperfect mutation (Table 4), has been able to obtain the support of certain workers [68]. The repeats of perfect and imperfect might be used to support the present findings in the form of polymorphism (Table 3). It has been categorically mentioned that the bulk of sample repeats are embedded in noncoding DNA sequence and it is assumed that such markers like microsatellites generally evolved naturally [58], however, demands further evaluation. The dominance of dinucleotide followed by others might be explained to the level of only microsatellite evolution [57]. The abundance of dinucleotide might also be evident in L. dubius (Table 4) and the existence of repeats having little or no dependence on the population size [67].

GenBank
Accession
number
Consensuses sequences with iterations and the (%) value of imperfect mutation within the
parenthesis, if any. The total number of base pairs were 2918
KY515267TCT (2)TCTG
(3.8%)
TCTT
(4.6%)
TCA (2)GAAA
(5.9%)
GA (3)
KY515268TCT (2)TCTG
(4.6%)
TCA (2)GTTTT
(2)
GACG
(3.8%)
GGGA
(3.8%)
AG (4)
KY515269GCAT
(2)
TCT (2)TCTG (4,
6%)
TCA (2)GAAA
(3.8%)
GACA
(5.8%)
AGA
(2)
TCG
(2)
KY515270CAGGG
(2)
TG
(8.6%)
AT (3)TA (3)TC (3)CAG (2)
KY515271CAGGG
(2)
TG
(9.5%)
AT (3)TA (3)TC (3)CCTT (2)TG (3)
KY515272TG
(9.5%)
AT (3)TA (3)TC (3)CCTT (2)TG (3)GTG
(2)
AGA
(2)
KY515273TTG (2)ATC (2)AT (3)GTAT
(2)
AGAA
(13.9%)
GAAA
(14.8%)
AAGA
(2)
ATG
(2)
GAAA
(9.5%)
AAGA
(2)
KY515274AG (3)TAC (2)CAA (2)TGC (2)A (5)G (5)
KY515275GCT (2)ACAGC
(2)
A (5)TG (3)GT (3)TA (3)
KY515276A (7)AT (3)GAACGC
(1)
KY515278CA (4)CTCA (2)TAC (2)GT (3)ATG (2)AGTG
(3.1%)
KY515279CA (4)CTCA (2)TAC (2)AG (4)AGCCTT
(2)

Table 4: Microsatellite repeat numbers for perfect and imperfect iterations are shown with repeat numbers for Mono (7), Di (9.5)

Table 4: Microsatellite repeat numbers for perfect and imperfect iterations are shown with repeat numbers for Mono (7), Di (9.5) Tri (2), Tetra (14.8), Penta (2) and Hexa at (2). Category wise dinucleotide numbers are TG=20, AT=15, AG=11, CA=8, TC=3, GT=3, CA=3, while the mononucleotides are A=12 and G=5 for the microsatellite representations. (% =Imperfection). ‘p %’ = Imperfection %.

The present analysis showed the dominance of dinucleotide followed by mono, di, tri, tetra, penta and hexa at only 2. And among the dinucleotide TG (20), AT (15), AG (11), CA (8) and GA, TA, TC, GT are at 3, while the mono A is at 12 as well as G is noted at 5. However, it is a matter fact, how microsatellites are defined, since among the repeats there are atleast 12 bp long mononucleotides repeats which outnumber dinucleotide repeats; the reverse situation is not valid until a higher threshold is used [67]. Among dinucleotide (TG)n repeats are the most frequent, followed by (AT)n, (CA)n and (GC)n, the last type of repeat being rare. Note that there are only four possible types of dinucleotide repeat, because CA = AC = GT = TG, GA = AG = CT = TC, AT = TA, and GC=CG [57]. Data, not to speak of stork, but also from other birds are least available till date. However, mouse genome has confirmed an impressive number of microsatellites (57,70]. A comparative analysis on the patterns of 3 avian microsatellites loci, chosen for three different class of microsatellites which are possibly in line with the present like perfect (GA)n repeat and other complex compound (GT)n, and (GA)n repeats both shows only moderate level of polymorphism, yet we demand further study over their aspects [70]. The recorded dinucleotide repeats were/are (Table 4) most prevalent followed by tri, mono, tetra, penta and hexa nucleotide motif respectively. The dinucleotide repeats have been known to be associated with copy number variations strand slippage and polymorphic, accounting for genome evolution and adaptation [71]. Further, the dinucleotide contribution towards SSR motifs extends a platform like repeat and another complete compound (GT). However, the microsatellite density has often been attempted to correlate with the genome size, yet the present investigation is data deficient in this direction. A model based on the distribution of microsatellite repeat length, which might be at equilibrium perhaps due to a balance between length and point mutation [72, 73], could not be extended to the present work. However, the tandem repeats [68] as presented in the Table 4 might be able to extend an explanation in the form of iterations of repeat units of a single nucleotide to hexanucleotide leading to the polymorphic chair, demands further detailed investigation.

It is an undeniable fact that there has been no genetic status report on the Greater Adjutant, which has been systematically disappearing. Yet, Zan and colleagues [74] analysed the sequences of 66 storks of Oriental white stork (Ciconia boyciana) and 17 storks from a Japanese population. An analysis of molecular variance showed a significant population subdivision between the two populations, where the Chinese population had a relatively higher genetic diversity with a haplotype diversity and nucleotide diversity [53]. However, the closer genetic relationship is obtainable in cross-specific amplification as evident in this study (Table 3). It has also been favoured that the observed low genetic variation in Mycteria Americana of Cuba with small colonies suffering from anthropogenic interferences [50] might be considered as valuable information for the conservation management of stork population in a given habitat. It may also be well argued that these sets of microsatellites used in this study proved to be useful for the Greater adjutant stork genetics and conservation implications. Earlier it has been advocated that they could be used for genetic linkage mapping in the common pheasants and its closely related pheasants [45, 64].

Conclusion

This research used five microsatellite markers that were cross-species specific. All five microsatellite markers were found to be polymorphic, with the number of alleles ranging from 2 to 9 in each locus. The locus Ah341 was found to have two alleles, while the locus Cc07 had nine. For the microsatellite markers used, the heterozygosity of L. dubius was found to be high, with a mean observed heterozygosity (H0) of 0.0.753 +/- 0.09 and a mean predicted heterozygocity (He) 0.677±06. The predicted heterozygosity was found to be slightly higher than the observed heterozygosity. It can be inferred that the microsatellites used in this analysis were beneficial to the genetics and conservation consequences of the Greater adjutant stork.

Authors Contributions

DKS and PDB were involved in planning, designing, and realizing the present work. PD performed the experiments and CB performed the data analysis. DKS and CB wrote the manuscript. All authors read, revised, and approved the final manuscript.

References

  1. Luthin CS (1987) Status of and conservation priorities for the world’s stork species. Colonial water birds. 10(2): 181-202.
  2. Jetz W, Thomas GH, Joy JB, Redding DW, Hartmann K, et al. (2014) Global distribution and conservation of evolutionary distinctness in birds. Curr Biol 24(9): 919- 930.
  3. IUCN (2018) The IUCN Red List of Threatened Species.
  4. Saikia PK, Bhattacharjee P (1989) Adjutant storks at risk in Assam, India. ICBP/IWRB specialist group on Storks, Ibises and Spoonbills Newsletter 2(1-2): 6-8.
  5. Rahmani AR, Maheshwaran G, Coulter MC (2004) Recent records of Black-necked Stork Ephippiorhynchus asiaticus in the Indian subcontinent. Forktail 5: 112-116.
  6. Rahmani AR, Narayan G, Rosalind L (1990) Status of the Greater Adjutant (Leptoptilos dubius) in the Indian Subcontinent. Colonial Waterbirds 13(2): 139-142.
  7. Choudhary SK, Dey S, Dey S, Mitra A (2004) Sighting of the Greater Adjutant stork Leptoptilos dubius in Vikramshila Gangetic Dolphin Sanctuary, Bihar, India. Journal of Bombay Natural History Society 101: 313-314.
  8. Hancock J, Kushlan JA, Kahl MP (1992) Storks, Ibises and Spoonbills of the World. Academic Press, pp: 385-392.
  9. Misra AM, Mandal JN (2010) Discovery of a breeding ground of the Greater Adjutant Leptotilus dubius and their conservation in the floodplains of Bihar, India. Journal of Bombay Natural History 106(2):190-197.
  10. Barman PD, Sharma DK, Cockrem JF, Malakar M, Kakati B (2020) Saving the Greater Adjutant Stork by Changing Perceptions and Linking to Assamese Traditions in India. Ethnobiology Letters 11(2): 20-29.
  11. Campbell IC, Poole C, Giesen W, Valbo-Jorgensen J (2006) Species diversity and ecology of Tonle Sap Great Lake, Cambodia. Aquatic Sciences 68(3): 355-373.
  12. Clements T, O’Kelly H, Sun V (2007) Monitoring of Large waterbirds at Prek Toal, Tonle Sap Great Lake 2001- 2007. Wildlife Conservation Society Cambodia Program, Phnom Penh, Cambodia, pp: 1-27.
  13. Birdlife International (2018) Species Factsheet: Leptoptilos dubius.
  14. Saikia PK, Bhattacharjee PC (1996) Studies on some aspects of breeding biology of Greater Adjutantt Stork, Leptoptilos dubius from the Brahmaputra Valley Assam. Tropical zoology 1(1): 57-64.
  15. Choudhury A (2000) The Birds of Assam. Gibbon Books and WWF, pp: 239.
  16. Saikia PK, Bhattacharjee P (1993) Present status and conservation of Wetland Birds in Brahamaputra Valley, Assam. Proceedings of Ornothological Society of India, pp: 20-27.
  17. Barman PD, Ali S, Deori P, Sharma DK (2015) Rescue, Treatment and Release of an endangered Greater Adjutant Leptoptilos dubius. Zoo’s Print 30(9): 6-9.
  18. Barooah D (1991) Greater Adjutant stork nesting in Assam. Newsletter for Birdwatchers. 30(7): 5-7.
  19. Saikia PK, Saikia MK, Bhattacharjee PC, Coulter MC, Sharma DK (2011) Conservation of Adjutant Stork (Ciconidae: Leptoptilos dubius and Leptoptilos javanicus) in South and Southeast Asia. India biodiversity portal 1: 189-211.
  20. Wood DS (1984) Concordance between classification of the Ciconidae based on behavioral and morphological data. Journal Fur Ornithologie 125 (1): 25-37.
  21. Kahl MP (1972) A revision of the family Ciconidae (aves). Journal of Zoology 167(4): 451-461.
  22. Kahl MP (1987) An overview of the storks of the world. Colonial Waterbirds 10(2): 131-134.
  23. Miller E, Rasmussen DT, Simons EL (1996) Fossil storks (Ciconiidae) from the late Eocene and early Miocene of Egypt. Ostrich 68(1): 23-26.
  24. Singha H, Rahmani AR, Coulter MC, Javed S (2002) Parental investment in the Greater Adjutant Stork (Leptotilus dubbius) in the Brahaputra valley of Assam, India. Malayan Nature Journal 56(3): 239-264.
  25. Barman PD, Sharma DK (2014) Conservation of Endangered Greater Adjutant in Assam India. Waterbirds of India 16: 202-209.
  26. Frederick P, Ogden JC (1997) Philopatry and Nomadism: Contrasting Long-Term Movement Behavior and Population Dynamics of White Ibises and Wood Storks. Colonial Waterbirds 20(2): 316-323.
  27. Barman PD (2018) Foraging Ecology, breeding success and genetic status of Greater Adjutant Stork Leptoptilos dubius Gmelin in Kamrup district, Assam. PhD thesis Gauhati University, India.
  28. Schlotterer C (2000) Evolutionary dynamics of microsatellite. Chromosoma 109(6): 365-371.
  29. Sreenu VB, Kumar P, Nagaraju J, Nagarajaram HA (2006) Microsatellite polymorphism across the M. tuberculosis and M. bovis genomes: Implications on genome evolution and plasticity. BMC Genomics 7: 78
  30. Sreenu VB, Kumar P, Nagaraju J, Nagarajaram HA (2007) Simple sequence repeats in mycobacterial genomes. J Biosci 32(1): 3-15.
  31. Miesfeld R, Krystal M, Amheim N (1981) A member of a new repeated sequence family which is conserved throughout eucaryotic evolution is found between the human δ and β globin genes. Nucleic Acids Res 9(22): 5931-5947.
  32. Stallings RL, Ford AF, Nelson D, Torney DC, Hildebrand CE, et al. (1991) Evolution and distribution of (GT) repetitive sequences in mammalian genomes. Genomics 10(3): 807-815.
  33. Dawson H, André S, Karamitopoulou E, Zlobec I, Gabius HJ (2013) The growing galectin network in colon cancer and clinical relevance of cytoplasmic galectin-reactivity. Anticancer Res 33(8): 3053-3059.
  34. Li YC, Korol AB, Fahima T, Nevo E (2004) Microsatellites within genes: structure, function, and evolution. Mol Biol Evol 21(6): 991-1007.
  35. Martin P, Makepeace K, Hill SA, Hood DW, Moxon ER (2005) Microsatellite instability regulates transcription factor binding and gene expression. Proc Natl Acad Sci USA 102(10): 3800-3804.
  36. Zane, LB, Patarlello T, Bargelloni L (2002) Strategies for microsatellite isolation: a review. Mol Ecol 11(1): 1-16.
  37. Li YC, Korol AB, Fahima T, Beiles A, Nevo E (2002) Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review. Mol Ecol 11(12): 2453-2465.
  38. Kashi, Y, King DG (2006) Simple sequence repeats as advantageous mutators in evolution. Trends Genet 22(5): 253-259.
  39. Meloni R, Albanèse V, Ravassard P, Treilhou F, Mallet J (1998) A tetranucleotide polymorphic microsatellite, located in the first intron of the tyrosine hydroxylase gene, acts as a transcription regulatory element in vitro. Human Molecular Genetics 7(3): 423-428.
  40. Sturzeneker R, Haddad LA, Bevilacqua RA, Simpson AJ, Pena SD (1998) Polarity of mutations in tumor- associated microsatellite instability. Hum Genet 102(2): 231-235.
  41. Benson G (1999) Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acid Res 27(2): 573- 580.
  42. Brinkmann B, Klintschar M, Neuhuber F, Hühne J, Rolf B (1998) Mutation rate in human microsatellites: influence of the structure and length of the tandem repeat. Am J Hum Genet 62(6): 1408-1415.
  43. Behura SK, Severson DW (2015) Motif mismatches in microsatellites: insights from genome-wide investigation among 20 insect species. DNA Res 22(1): 29-38.
  44. Murata K, Satou M, Matsushima K, Satake S, Yamamoto Y (2004) Retrospective estimation of genetic diversity of an extinct Oriental White Stork (Ciconia boyciana) population in Japan using mounted specimens and implications for reintroduction programs. Conservation Genetics 5(4): 553- 560.
  45. Haig SM, Bronaugh WM, Crowhurst RS, D’elia J, Eagles- Smith CA, et al. (2011) Genetic applications in avian conservation. The Auk 128(2): 205-229.
  46. Zane L, Bargelloni L, Pattranello T (2002) Strategies for microsatellite isolation: a review. Mol Ecol 11(1): 1-16.
  47. Shephard JM, Galbusera P, Hellemans B, Jusic A, Akhandaf Y (2009) Isolation and characterization of a new suite of microsatellite markers in the European white stork Ciconia ciconia. Conservation Genetics 10: 1525-1528.
  48. de Castro E, Souza AS, Miño CI, Lama SN (2012) Polymorphic heterologous microsatellite loci for population genetics studies of the white-faced ibis Plegadis chihi (Vieillot, 1817) (Pelecaniformes, Threskiornithidae). Genet Mol Biol 35(1): 74-80.
  49. Sharma BB, Banerjee BD, Urfi AJ (2017) A preliminary study of cross-amplified microsatellite loci using molted feathers from a near-threatened Painted Stork (Mycteria leucocephala) population of north India as a DNA source. BMC Research Notes 10(1): 604.
  50. Llanes–Quevedo A, Alfonso González M, Cárdenas MR, Frankel C, Espinosa LG (2018) Microsatellite variability of the wood stork Mycteria americana (Aves, Ciconidae) in Cuba: implications for its conservation. Animal Biodiversity and Conservation 41(2): 357-364.
  51. Jangtarwan K, Koomgun, Prasongmaneerut T, Thongchum R, Singchat W, et al. (2019) Take one step backward to move forward: Assessment of genetic diversity and population structure of captive Asian woolly-neckeed storks (Ciconia episcopus). PLoS One 14(10): 1-12.
  52. McGuire HL, Noor MA (2002) Microsatellite loci for great white herons and great blue herons (Aves, Ardeidae, Ardea herodias). Molecular Ecology Notes 2(2): 170-172.
  53. Huang Y, Zhou L (2011) Screening and application of microsatellite markers for genetic diversity of Oriental white Sork (Ciconia boyciana). Chinese birds 2(1): 33-38.
  54. Ausubel FM, Brent R, Kingsten RE, Moore DD, Seidman JG, et al. (1996) Short Protocols in Molecular Biology 3rd (Edn) John Wiley and Sons, New York 24(1): 68.
  55. Wilson AJ, Hutchings JA, Ferguson MM (2004) Dispersal in a stream dwelling salmonid: inferences from tagging and microsatellite studies. Conservation Genetics 5(1): 25-37.
  56. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215(3): 403-410.
  57. Ellegren H (2004) Microsatellite simple sequences with complex evolution. Nat. Rev Genet 5(6): 435-445.
  58. Katti MV, Ranjekar PK, Gupta VS (2001) Differential distribution of simple sequence repeats in eukaryotic genome sequences. Mol Biol Evol 18(7): 1161-1167.
  59. Mudunuri SB, Nagarajaram HA (2007) IMEx: Imperfect Microsatellite Extractor. Bioinformatics 23(10): 1181- 1187.
  60. Nei M (1973) Analysis of Gene diversity in subdivided populatios. Proc Natl Acad Sci USA 70(12): 3321-3323.
  61. Belkhir K (1999) Genetix: logiciel sous Windows TM pour la génétique des populations. Laboratoire Genóme, Populations, Interations. CNRS UPR 9060, Université Montpellier II, Montpellier, France.
  62. Fonteque GV, Battilana J, Paludo E, Lima-Rosa CA (2014) Genetic polymorphism of fifteen microsatellite loci in Brazilian (blue-egg Caipira) chickens. Pesquisa Veterinária Brasileira 34(1): 98-102.
  63. Singha, H (1998) Breeding behavior of Greater Adjutant Stork Leptotilus dubius (Gmelin) in Assam, India, Doctoral Dissertation, Aligarh University, India.
  64. Wang N, Liu Y, Zhang ZW (2009) Characterization of nine microsatellite loci for a globally vulnerable species, Reeves’s Pheasant (Syrmaticus reevesii). Conserv Genet 10: 1511-1514.
  65. Dawson DA, Horsburgh GJ, Kupper C, Stewart IR, Ball AD, et al. (2010) New methods to identify conserved microsatellite loci and develop primer sets of high cross-species utility-as demonstrated for birds. Mol Ecol Resour 10(3): 475-494.
  66. Gu LY, Liu Y, Wang N, Zhang ZW (2012) A panel of polymorphic microsatellites in the Blue Eared Pheasant (Crossoptilon auritum) developed by cross-species amplification. Chinese Birds 3(2):103-107.
  67. Amos W (2016) Heterozygosity increases microsatellite mutation rate. Biology Letters 12: 20150929.
  68. Wexler Y, Yakhini Z, Kashi Y, Geiger D (2005) Finding approximate Tandem repeats in Genomic sequences. J Comput Biol 12(7): 928-942.
  69. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32(3): 314-331.
  70. Primmer CR Ellegren H (1998) Patterns of molecular evolution of Avian microsatellites. Molecular Biology and Evolution 15(8): 997-1008.
  71. Alam MC, Iqbal A, Sharma A, Schulmann AH, Ali S (2019) Microsatellite diversity, complexity and host range of Mycobacterophage genomes of the Siphovirridae Family. Front Genet 10: 207.
  72. Bell GI, Jurka J (1997) The length distribution of perfect dimer repetitive DNA is consistent with its evolution by an unbiased single-step mutation process. Journal of Molecular Evolution 44: 414-421.
  73. Kruglyak S, Durrett RT, Schug MD, Aquadro CF (1998) Equilibrium distributions of microsatellite repeat length resulting from a balance between slippage events and point mutations. Proc Natl Acad Sci USA 95(18): 10774- 10778.
  74. Zan ST, Zhou IZ, Jiang H, Zhang BW, Wu ZA, et al. (2008) Genetic structure of the Oriental white stork (Ciconia boyciana): Implications for a breeding colony in a non- breeding area. Integr Zool 3(3): 235-244.
  75. Haig SM, Miller MP, Bellinger MR, Draheim HM, Mercer DM (2016) The Conservation genetics juggling act: integrating genetics and ecology, science and policy. Evolutionary Applications 9(1): 181-195.
  76. Wang B, Xie X, Wang X, Pang H, Liu Y (2017) Development and characterization of novel microsatellite markers for the Common Pheasant (Phasianus colchicus) using RAD- seq. Avian Research 8: 4.

Cite this article

BibTeX
APA
RIS
@article{sharma2021,
  title   = {Perfect and Imperfect Microsatellite Markers in Determination
of Genetic Status of Greater Adjutant Stork (Leptoptilos dubius
Gmelin)},
  author  = {Sharma DK, Baruah C and Barman PD},
  journal = {Bioinformatics & Proteomics Open Access Journal},
  year    = {2021},
  volume  = {5},
  number  = {1},
  doi     = {10.23880/bpoj-16000137}
}
Sharma DK, Baruah C and Barman PD (2021). Perfect and Imperfect Microsatellite Markers in Determination
of Genetic Status of Greater Adjutant Stork (Leptoptilos dubius
Gmelin). Bioinformatics & Proteomics Open Access Journal, 5(1). https://doi.org/10.23880/bpoj-16000137
TY  - JOUR
TI  - Perfect and Imperfect Microsatellite Markers in Determination
of Genetic Status of Greater Adjutant Stork (Leptoptilos dubius
Gmelin)
AU  - Sharma DK, Baruah C and Barman PD
JO  - Bioinformatics & Proteomics Open Access Journal
PY  - 2021
VL  - 5
IS  - 1
DO  - 10.23880/bpoj-16000137
ER  -