TCF7L2 Gene Rs7903146 Polymorphism May Confer Expression of Gestational Diabetes Mellitus in Relatively Young and Lean Mothers
To observe the impact of clinical characteristics and TCF7L2 rs7903146 polymorphism on GDM, pregnant women without history of glucose intolerance [N=100; age 26.22 ± 4.56 years; body mass index (BMI) 26.39 ± 3.85; mean ± SD; GDM=50, normal glucose tolerance (NGT=50) according to WHO 2013 criteria] were studied for TCF7L2 rs7903146 polymorphism using Sanger sequencing technique (genotype CC=63, CT/TT=37) of genotyping. Women with CC and CT/TT genotypes had no significant difference of age (CC vs. CT/TT: 26.10 ± 4.46 vs. 26.43 ± 4.79 years, p=0.723; mean ± SD) or BMI (CC vs. CT/TT: 26.21 ± 3.90 vs. 26.69 ± 3.79 kg/m2, p=0.548; mean ± SD). While GDM women with CC genotype had higher age and BMI than NGT women (GDM vs. NGT: age 27.96 ± 3.79 vs. 24.60 ± 4.45 years, p=0.002; BMI: 27.67 ± 3.93 vs. 25.04 ± 3.50 kg/m2, p=0.006; mean ± SD), GDM women with CT/TT genotype had no significant difference of age and BMI with NGT women (GDM vs. NGT: age 27.00 ± 5.22 vs. 25.60 ± 4.10 years, p=0.390; BMI: 26.48 ± 3.63 vs. 27.00 ± 4.13 kg/m2, p=0.688; mean ± SD). In women of age
Mashfiqul-Hasan, Nusrat-Sultana, Sharmin-Jahan, Sandesh-Panthi,
Yasmin-Aktar, Atiqur-Rahman M, Fariduddin M and Hasanat MA*
Bangladesh
mail: hasanatdr@yahoo.com with young age and lean BMI.
Keywords: TCF7L2; GDM; Polymorphism
Introduction
Although pregnancy is a condition characterized by progressive insulin resistance, glucose intolerance develops in only a small proportion of pregnant women [1]. Normally, the increased insulin resistance during pregnancy is compensated by the increase in insulin secretion by pancreatic islet β-cells that undergo structural and functional changes in response to the increased insulin requirements [2]. As a result, the changes in circulating glucose levels over the course of pregnancy are quite small, compared with the large changes in insulin sensitivity [1]. Gestational diabetes mellitus (GDM) can develop when a genetic predisposition of pancreatic islet β-cell impairment is unmasked by the increased insulin resistance during pregnancy [2]. Among widely studied genes of GDM, most are thought to modulate pancreatic islet β-cell function [3]. Likewise, there is ample evidence supporting transcription factor 7 like 2 (TCF7L2) as a GDM susceptibility gene, possibly by altering insulin secretion. Worth mentioning that few investigators have observed such relationship of gestational diabetes with alteration or polymorphism of genetic locus [3, 4, 5, 6, 7, 8, 9, 10]. No significant studies are carried out over this area in Bangladesh as yet; as a matter of fact, numbers of studies even in the Asian region is very scanty. The risk factors of glucose intolerance in pregnancy include maternal age, body mass index (BMI) and family history of diabetes [11, 12]. As glucose intolerance is interplay between insulin resistance and secretory defect of β-cell, it is difficult to predict the effect of those risk factors in women harbouring a genetic alteration like TCF7L2 rs7903146 polymorphism. Again, risk conferred by a particular genetic polymorphism may not be similar in different groups of subjects with different clinical characteristics. In this perspective the present study was carried out to observe clinical characteristics and their impact on risk of GDM in relation to TCF7L2 rs7903146 polymorphism in women undergoing screening for GDM with the aim to focus on the importance of genetic studies in GDM among Bangladeshi mothers.
Materials and methods
Study design
In this cross-sectional study, single nucleotide polymorphism (SNP) of TCF7L2 rs7903146 was investigated in 100 pregnant mothers (age: 26.22 ± 4.56 years, BMI 26.39 ± 3.85 kg/m2; mean ± SD) undergoing screening for GDM. Mothers were screened consecutively by 75-gm 3-samples oral glucose tolerance test (OGTT) following WHO 2013 criteria for GDM to include 50 women with GDM (age: 27.54 ± 4.45 years, BMI 27.15 ± 3.81 kg/m2; mean ± SD) and equal number of women with normal glucose tolerance (NGT) (age: 24.90 ± 4.33 years, BMI: 25.62 ± 3.77 kg/m2; mean ± SD). Those who underwent OGTT before 24 weeks of gestation were assigned to study group on the basis of repeat OGTT after 24 weeks of gestation (n=18; GDM=5, NGT=13). On the other hand, any subject falling into criteria of ‘Diabetes in pregnancy’ (0-h PG ≥ 7.0 and/or 02-h PG ≥11.1 mmol/L) was excluded. Relevant clinical and biochemical data including hemoglobin A1c (HbA1c) and plasma glucose (PG) were recorded (Table-1).
| Variables | All subjects |
|---|---|
| N | 100 |
| Age in years (mean ± SD) | 26.22 ± 4.56 |
| BMI in kg/m² (mean ± SD) | 26.39 ± 3.85 |
| Parity | |
| Primipara | 41 (41) |
| Multipara | 59 (59) |
| Family history of DM in 1st degree relatives | 36 (36) |
| Glycemic status (GDM/NGT) | 50/50 |
Table 1: Characteristics of the study subjects.
Assay methods
Plasma glucose was assayed by glucose-oxidase method while HbA1c was measured using the Bio-Rad D- 10TM HbA1c Program 220-0101 (USA) certified by National Glycohemoglobin Standardization Program. Inter-assay co-efficient variance (CV) for glucose was 4.44%.
Genotyping
Blood samples in duplicate were collected in a VACUETTE® EDTA K3 (Greiner Bio-One GmbH) tube. Genomic DNA was extracted using QIAmp DNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany). Extracted DNA was quantified by Quantus fluorometer (Promega Corporation, USA). TCF7L2 locus was amplified by polymerase chain reaction (PCR) using commercial PCR kit (GoTaq, Promega Corporation, USA). The PCR primers were designed by Primer Express and optimized according to the manufacturer's protocol. Forward and reverse primers used were 5/AGATTCCTTTTTAAATGGTGACA3/ and 5/GCATTACAAATTATTAGAACTTTCA3/. The amplicons were then electrophoresed in a 2% agarose gel to assess PCR efficacy and to detect the presence of the 356-bp of TCF7L2 locus. Sanger’s di-deoxy chain terminating method was used to sequence the amplified TCF7L2 locus. Chain terminating cycle sequencing for both forward and reverse primer was performed using sequencing kit (BigDye Terminator v3.1, Applied Biosystems, Foster City, Calif. USA). Capillary electrophoresis was performed using ABI 3500Dx Genetic Analyzer (Applied Biosystems, Foster City, Calif. USA). Sequences were analyzed to determine the genotype using SeqScape software (Applied Biosystems, Foster City, Calif. USA). Genotyping results were validated by re-sequencing 10% of randomly selected samples. No differences were found, thus the genotyping error rate was 0%.
Statistics
Data were expressed as frequencies or percentages and mean (±SD) as applicable. Association of outcome variables were assessed by χ2-test and expressed with odds ratio (OR) and 95% confidence interval (CI). To compare the quantitative characteristics (age, BMI, plasma glucose values, HbA1c) unpaired t-test was done and to compare the qualitative characteristics (occupation, family history) χ2-test was done between groups. P values ≤ 0.05 were considered as significant.
Results
The present study comprised 63 women with common variant CC (cytosine in both allele) genotype and 37 women with CT (cytosine in one and thymine in another allele) or TT (thymine in both allele) genotype of TCF7L2 rs7903146 polymorphism. In comparison to women with CC genotype of TCF7L2 rs7903146 polymorphism, women with CT/TT genotype had no significant difference of age (CC vs. CT/TT: 26.10 ± 4.46 vs. 26.43 ± 4.79 years, p=0.723; mean ± SD) or BMI (CC vs. CT/TT: 26.21 ± 3.90 vs. 26.69 ± 3.79 kg/m2, p=0.548; mean ± SD). HbA1c was significantly higher in woman with CT/TT genotype (CC vs. CT/TT: 5.08 ± 0.50 vs. 5.29 ± 0.45, p=0.038; mean ± SD). Frequency of family history of Diabetes Mellitus was similar in both groups (CC vs. CT/TT: 35% vs. 38%, p=0.769) (Table 2).
| Variables | CC | CT+TT | p |
| Variables | (n=63) | (n=37) | p |
| Age in years (mean ± SD) | 26.10 ± 4.46 | 26.43 ± 4.79 | 0.723 |
| BMI (mean ± SD) | 26.21 ± 3.90 | 26.69 ± 3.79 | 0.548 |
| Family history of DM | 22 (34.9) | 14 (37.8) | 0.769 |
| *HbA1c (mean ± SD) | 5.08 ± 0.50 | 5.29 ± 0.45 | 0.038 |
| GDM | 28 (44.4) | 22 (59.5) | 0.147 |
Table 2: Clinical and biochemical characteristics of TCF7L2 rs7903146 variants.
Table 2: Clinical and biochemical characteristics of TCF7L2 rs7903146 variants. (Within parenthesis are percentages over column total) by Student’s t-test and χ2 test *Not done in 1 GDM woman TCF7L2: Tranascription factor 7 like 2 GDM: gestational diabetes mellitus BMI: body mass index (kg/m2) DM: diabetes mellitus C: Cytosine T: Thymine HbA1c: hemoglobin A1c (%) When comparison was made between women with CC genotype and those with CT/TT genotype within GDM and (NGT) group, it was observed that there was no significant difference in relation to age, BMI, family history of DM, PG and HbA1c (Table 3). But when those parameters were compared between GDM and NGT women within two separate genotype groups (CC vs. CT/TT), it was observed that, while GDM women with CC genotype had higher age and BMI than NGT women (GDM vs. NGT: age 27.96 ± 3.79 vs. 24.60 ± 4.45 years, p=0.002; BMI: 27.67 ± 3.93 vs. 25.04 ± 3.50 kg/m2, p=0.006; mean ± SD), GDM women with CT/TT genotype had no significant difference of age and BMI with NGT women (GDM vs. NGT: age 27.00 ± 5.22 vs. 25.60 ± 4.10 years, p=0.390; BMI: 26.48 ± 3.63 vs. 27.00 ± 4.13 kg/m2, p=0.688; mean ± SD). Comparison of other characteristics (family history of DM, HbA1c) was observed to have similar pattern between women with GDM and NGT within two genotype group (Table 4).
| GDM | NGT | ||||||
|---|---|---|---|---|---|---|---|
| Variables | CC(n=28) | CT+TT(n=22) | p | CC(n=35) | CT+TT(n=15) | p | |
| Variables | Age in years(mean ± SD) | 27.96 ± 3.79 | 27.00 ± 5.22 | 0.453 | 24.60 ± 4.45 | 25.60 ± 4.10 | 0.46 |
| BMI(mean ± SD) | 27.68 ± 3.93 | 26.48 ± 3.63 | 0.275 | 25.04 ± 3.50 | 27.00 ± 4.13 | 0.091 | |
| Family history of DM | 14 (50.0) | 11 (50.0) | 1 | 8 (22.9) | 3 (20.0) | 0.823 | |
| 0-h PG(mean ± SD) | 4.78 ± 0.83 | 4.90 ± 0.68 | 0.561 | 4.22 ± 0.41 | 4.17 ± 0.43 | 0.723 | |
| *01-h PG(mean ± SD) | 9.74 ± 2.06 | 9.94 ± 1.64 | 0.719 | 7.27 ± 1.18 | 7.56 ± 1.03 | 0.416 | |
| 02-h PG(mean ± SD) | 8.39 ± 1.42 | 8.18 ± 1.54 | 0.608 | 6.16 ± 1.18 | 6.63 ± 1.00 | 0.188 | |
| *HbA1c(mean ± SD) | 5.20 ± 0.55 | 5.40 ± 0.42 | 0.176 | 4.99 ± 0.44 | 5.14 ± 0.47 | 0.286 | |
Table 3: Comparison of clinical and biochemical characteristics between different variants of TCF7L2 rs7903146 in GDM Table 3: Co
Table 3: Comparison of clinical and biochemical characteristics between different variants of TCF7L2 rs7903146 in GDM Table 3: Comparison of clinical and biochemical characteristics between different variants of TCF7L2 rs7903146 in GDM and NGT subjects. Within parenthesis are percentages over column total by Student’s t-test and χ2 test *Not done in 1 GDM woman with CC TCF7L2: Tranascription factor 7 like 2 GDM: gestational diabetes mellitus NGT: normal glucose tolerance HbA1c: hemoglobin A1c (%) BMI: body mass index (kg/m2) DM: diabetes mellitus C: Cytosine T: Thymine PG: plasma glucose (mmol/L)
| CC | CT+TT | |||||
|---|---|---|---|---|---|---|
| Variables | GDM (n=28) | NGT (n=35) | p | GDM (n=22) | NGT (n=15) | p |
| Age (yrs, mean ± SD) | 27.96 ± 3.79 | 24.60 ± 4.45 | 0.002 | 27.00 ± 5.22 | 25.60 ± 4.10 | 0.39 |
| BMI (mean ± SD) | 27.67 ± 3.93 | 25.04 ± 3.50 | 0.006 | 26.48 ± 3.63 | 27.00 ± 4.13 | 0.688 |
| Family history of DM | 14 (50.0) | 8 (22.9) | 0.025 | 11 (50.0) | 3 (20.0) | 0.065 |
| *HbA1c (mean ± SD) | 5.20 ± 0.55 | 4.99 ± 0.44 | 0.096 | 5.40 ± 0.42 | 5.14 ± 0.47 | 0.088 |
Table 5: Comparison of clinical and biochemical characteristics between GDM and NGT women in subjects with variants (95% CI 1.377
Table 4: Comparison of clinical and biochemical characteristics between GDM and NGT women in subjects with variants (95% CI 1.377-32.114) for GDM. But this was not observed in women who are ≥25 year old (CT/TT vs. CC 60% GDM in both groups, p=1.000, OR=1.000, 95% CI 0.361-2.773; (Table 5). Using BMI cut-off at 25 kg/m2, it was observed that in women with BMI <25 kg/m2 frequency of GDM was significantly higher in those with CT/TT genotype than those with CC (CT/TT vs. CC: 61.5% vs. 18.2%, p=0.024) with an OR of 7.200 (95% CI 1.518- 34.139). No increased risk of GDM was found according to genotype difference in women having BMI ≥25 kg/m2 (CT/TT vs. CC 58.3% vs. 58.5%, p=0.987, OR=0.992, 95% CI 0.357-2.86; (Table 6).
| Variables | CC(n=28) | CT+TT(n=22) | p | CC(n=35) | CT+TT(n=15) | p |
| GDM | NGT | Total | p | OR (95% CI) | |
|---|---|---|---|---|---|
| Age <25 years | |||||
| CC | 4 (17.4) | 19 (82.6) | 23 | 6.65 | |
| CT/TT | 7 (58.3) | 5 (41.7) | 12 | p=0.022 | (1.377-32.114) |
| Total | 11 (31.4) | 24 (68.6) | 35 | ||
| Age ≥25 years | |||||
| CC | 24 (60.0) | 16 (40.0) | 40 | 1 | |
| CT/TT | 15 (60.0) | 10 (40.0) | 25 | p=1.000 | (0.361-2.773) |
| Total | 39 (60.0) | 26 (40.0) | 65 | ||
Table 6: Glycemic outcome in mothers with TCF7L2 rs7903146 risk variant according to age cut-off.
T: Thymine C: Cytosine
| Variables | GDM | NGT | Total | p | OR (95% CI) |
| BMI <25 kg/m² | |||||
| CC | 4 (18.2) | 18 (81.8) | 22 | 7.2 | |
| CT/TT | 8 (61.5) | 5 (38.5) | 12 | p=0.024 | (1.518-34.139) |
| Total | 11 (34.3) | 23 (65.7) | 35 | ||
| BMI ≥25 kg/m² | |||||
| CC | 24 (58.5) | 17 (41.5) | 41 | 0.992 | |
| CT/TT | 14 (58.3) | 10 (41.7) | 24 | p=0.987 | (0.357-2.756) |
| Total | 38 (58.5) | 27 (41.5) | 65 |
Table 7: Comparison of glycemic outcome in mothers with TCF7L2 rs7903146 risk variant according to BMI cut-off.
Discussion
In the present study, it was observed that the mothers with polymorphism of TCF7L2 rs7903146 (CC and CT/TT genotypes) had similar clinical characteristics like age, BMI and family history of DM as well as frequency of GDM with these genotypes. Unlike the higher age and BMI associated with GDM in comparison to NGT women in CC genotype, comparison of GDM and NGT mothers for age and BMI, we observed no significant difference for these factors in the genotype CT/TT. In light of these features, the risk conferred by variants of TCF7L2 rs7903146 was analysed separately in lower age and BMI groups. The mothers with CT/TT genotype had significantly higher frequency and risk of GDM in lower age and BMI groups, but not in higher age and BMI groups which supports the concept that genetic alteration influences over the secretory potential of β-cells function in GDM mothers. Previous investigators had observed poor β-cell function in relatively lean individual with risk variants of TCF7L2 polymorphism [5]. Similar finding was observed by Cauchi et al. in T2DM, where they found the risk to be highest in relatively lean individuals by restricting their analysis to lean subjects (BMI <30 kg/m2) [13]. They commented that the strong association of rs7903146 T allele with T2DM in non-obese subjects makes it unlikely that the TCF7L2 diabetogenic effect directly involves insulin sensitivity or fat deposition. Rather it points towards defect of insulin secretion by β-cells. The negative association between TCF7L2 polymorphism and BMI does not necessarily imply that TCF7L2 polymorphism leads to reduced BMI, as it could simply reflect the joint independent risk of BMI and TCF7L2 polymorphism [14]. Although risk conferred by genetic polymorphism always persists, its effect may be diluted by contribution of other risk factors including increasing age and BMI. As a result, genetic risk conferred by the rs7903146 T allele may be more important in those who are relatively young and lean. In consistent with this, we have clearly observed that GDM mothers having relatively lower age and BMI had higher frequency of polymorphism of TCF7L2 gene (CT/TT) in comparison to the NGT mothers; conversely, frequency of normal (CC) and altered (CT/TT) genotypes were found to be similar for GDM in relatively elderly mothers with higher BMI. These findings further strengthen the belief that genetic alteration strongly influences over β-cell function, insulin secretion and expression of GDM. Family history of DM in 1st degree relatives is also considered to be a risk factor of GDM [11, 15]. However, being a polygenic disorder with multiple environmental impacts, it is difficult to correlate the family history of DM and polymorphism of a single locus. As such frequency of family history of DM was found to be increased in GDM women irrespective of genotype of TCF7L2. This increased frequency of family history may reflect the impact of multiple genetic polymorphisms, assessment of which is beyond the scope of present study. HbA1c was observed to be significantly elevated in women with CT/TT genotype in comparison to CC, though in narrow margin. It may reflect the increased frequency of GDM in those with CT/TT. In conclusion, polymorphism of TCF7L2 rs7903146 may confer increased risk of GDM even in mothers with young age and lean BMI.
Acknowledgements
The authors gratefully acknowledge the scientific colleagues of the department for their generous and moral support to the project. Supporting staffs of the department and patients participating in the project are also thanked and appreciated. Novo Nordisk Pharma Bangladesh is acknowledged for their financial help.
References
-
Buchanan TA, Xiang AH (2005) Gestational diabetes mellitus. J Clin Invest 115(3): 485-491.
-
Di-Cianni G, Miccoli R, Volpe L, Lencioni C, Del-Prato S (2003) Intermediate metabolism in normal pregnancy and in gestational diabetes. Diabetes Metab Res Rev 19(4): 259-270.
-
Zhang C, Bao W, Rong Y, Yang H, Bowers K, et al. (2013) Genetic variants and the risk of gestational diabetes mellitus: a systematic review. Hum Reprod Update 19(4): 376-390.
-
Gloyn AL, Braun M, Rorsman P (2009) Type 2 diabetes susceptibility gene TCF7L2 and its role in β- cell function. Diabetes 58(4): 800-802.
-
Watanabe RM, Allayee H, Xiang AH, Trigo E, Hartiala J, et al. (2007) Transcription factor 7-like 2 (TCF7L2) is associated with gestational diabetes mellitus and interacts with adiposity to alter insulin secretion in Mexican Americans. Diabetes 56(5): 1481-1485.
-
Watanabe RM, Black MH, Xiang AH, Allayee H, Lawrence JM, et al. (2007) Genetics of gestational diabetes mellitus and type 2 diabetes. Diabetes Care 30(S2): S134-S140.
-
Mitchell RK, Mondragon A, Chen L, Mcginty JA, French PM, et al. (2014) Selective disruption of Tcf7l2 in the pancreatic β cell impairs secretory function and lowers β cell mass. Human Mol Genet. 24(5): 1390- 1399.
-
Kwak SH, Jang HC, Park KS (2012) Finding genetic risk factors of gestational diabetes. Genomics Inform 10(4): 239-243.
-
Shaat N, Lernmark A, Karlsson E, Ivarsson S, Parikh H, et al. (2007) A variant in the transcription factor 7- like 2 (TCF7L2) gene is associated with an increased risk of gestational diabetes mellitus. Diabetologia 50(5): 972-979.
-
Papadopulou A, Lynch KF, Shaat N, Hakansson R, Ivarsson SA, et al. (2011) Gestational diabetes mellitus is associated TCF7L2 gene polymorphisms independent of HLA-DQB1*0602 genotypes and islet cell autoantibodies. Diabet Med 28(9): 1018-1027.
-
Sandesh-Panthi, Hasanat MA, Mashfiqul-Hasan, Yasmin-Aktar, Nusrat-Sultana, et al. (2015) Frequency of gestational diabetes mellitus in Bangladesh, impact of WHO 2013 screening criteria: efficiency of DIPSI and WHO 1999 criteria. JCD 2(2): 13-19.
-
Nusrat-Sultana, Hasanat MA, Sharmin-Jahan, Mashfiqul-Hasan, Yasmin-Aktar et al. (2016) Association of risk factors in gestational diabetes mellitus among pregnant mothers attending at a tertiary care hospital in Bangladesh. JBD 1(2): 54-60.
-
Cauchi S, Meyre D, Dina C, Choquet H, Samson C, et al. (2006) Transcription factor TCF7L2 genetic study in the French population: expression in human β-Cells and adipose tissue and strong association with type 2 diabetes. Diabetes 55(10): 2903-2908.
-
Helgason A, Palsson S, Thorleifsson G, Grant SFA, Emilsson V, et al. (2007) Refining the impact of TCF7L2 gene variants on type 2 diabetes and adaptive evolution. Nat Genet 39(2): 218-225.
-
Nusrat-Sultana, Hasanat MA, Khorshed-Alam, Sharmin-Jahan, Mashfiqul-Hasan, et al. (2016) Alarming frequency of gestational diabetes mellitus (GDM) attending a tertiary care hospital in Bangadesh. JCD 2(4): 1-5.
- Investigation of Polymorphisms in PPAR-Ɣ and TRHR Genes and their Impact on Turkish Diabetic and Obese Individuals
- The Impact of Aircraft Noise Exposure on the Efficacy of Empagliflozin Therapy in an Animal Model of Obesity
- Rooibos Mitigates Metabolic and Inflammatory Dysfunctions in Mice Fed a High-Carbohydrate Diet
- Synergistic Effect of Combined Leaf Extract of Vernonia amygdalina, Ocimum gratissimum, and Zingiber officinale Tuber on Phytochemical Profile, Antioxidant Activity, Serum Insulin, and Biochemical Parameters in Streptozotocin-Induced Diabetic Rats
- Investigation of Cardiovascular Responses to Aerobic Exercise in Obese University Students
- A Look at the Phase Angle Obtained by Electrical Bioimpedance