Alpha-Synuclein Overexpression Causes Mild Hearing Loss and Protection from Noise Trauma

Animals

FVB alpha synucleins (α-Syn) over-expression mice were provided by Dr. Robert Edwards of the University of California, San Francisco, and Department of Neurology. The general and central nervous system phenotype of this mouse has been described previously Nemani VM, et al. [30]. All procedures and animal handling were done according to national ethical guidelines and were approved and complied with all protocol requirements of the University of California, San Francisco Institutional Animal Care and Use Committee.

Auditory Tests

Hearing tests were performed as previously described Akil O, et al. [31] with α-Syn over-expression (transgenic) and wild-type (WT) mice littermates at different postnatal ages (1-10 months (P1-P10mo)). Briefly, all auditory testing was performed in a sound-proof chamber. Before acoustic testing, mice were anesthetized by intraperitoneal injection of a mixture of Ketamine hydrochloride (Ketaset, 100 mg/ ml) and xylazine hydrochloride (xyla-ject, 10mg/ml), with supplements of one fifth the original dose administered as required. Body temperature was maintained with a heating pad and monitored with a rectal probe throughout recordings. Auditory Brainstem Response Measurement: The auditory brainstem response (ABR) thresholds were differentially recorded from the scalp of the transgenic and WT mice littermates. Responses were recorded using subdermal needle electrodes at the vertex, below the pinna of the left ear (reference), and below the contralateral ear (ground). The sound stimuli were clicks (5ms duration; 31Hz) and tone pips at 8, 16, and 32 kHz (10ms duration; cos2 shaping; 21Hz). Measurements were recorded using the TDT BioSig III system (Tucker Davis Technologies). For each stimulus, electroencephalographic (EEG) activity was recorded for 20 ms at a sampling rate of 25kHz, filtered (0.3- 3kHz), and waveforms from 512 stimuli were averaged for click responses, and 1000 stimuli for tonal stimuli (8, 16 and 32 kHz). ABR waveforms were recorded in 5 dB sound pressure level (SPL) intervals down from the maximum amplitude. The threshold was defined as the lowest stimulus level at which response peaks for wave’s I-V were clearly and reproducibly present upon visual inspection. These threshold judgments were confirmed by analysis of stored waveforms. Data were obtained from the transgenic (n=9), and WT (n=6) mice littermates at varying ages including P30 to P10months. The comparisons of animal groups were performed using 1-way ANOVA with Bonferroni post-hoc testing. Significance was defined at p <0.05. To asses changes in ABR latencies, the ABR peaks and troughs were identified automatically by cursers programmed to identify each peak using the Tucker-Davis Technologies system software, and then verified by visual inspection of the recorded wave forms. Latencies were calculated from the onset of the stimulus, and the interpeak latency calculated by subtraction of wave II-I (P2 - P1). Differences in interpeak latency were then calculated at two different intensity levels (90 and 80 dB SPL). ABR Wave I amplitude analysis was also done by peak- to-peak measurement of the stored click ABR waveforms at two different intensity levels (90 and 80 dB SPL). Compound Action Potential Recording: Compound action potential (CAP) recording was performed as previously described Seal RP, et al. [32]. A dorsal surgical approach Akil O, et al. [33] was used to expose the left cochlea of the transgenic (n=6) and WT mice littermates (n=4) for recordings. After making a small opening in the bulla and visualizing the round window niche, a fine recording electrode, fashioned from Teflon coated-insulated silver wire, was positioned in the round window niche and another was placed in the soft tissue of the neck as a ground electrode. The sound stimulus was generated with Tucker-Davis System II hardware and software (Tucker-Davis). The CAP thresholds were measured using click stimuli. Response to these inputs were measured at the round window of the transgenics at P30 and compared to responses obtained from the WT littermate’s mice. Distortion Product Otoacoustic Emissions Measurement: The distortion product otoacoustic emissions (DPOAEs) were measured using an acoustic probe placed in the left external auditory canal. Stimuli consisted of two primary tones (f1/f2=1.25) digitally synthesized at 100 kHz using SigGen software. The primary tones with geometric mean (GM) frequencies ranging from 6 to 36 kHz and equal levels (L1 = L2 = 60 dB SPL) were presented via two separate speakers (EC1; Tucker Davis Technologies, Alachua, FL) to the acoustic probe. DPOAE 2f1–f2 responses were recorded using an ER10B (Etymotics Research, Elk Grove Village, IL) microphone assembly within the acoustic probe and the TDT BioSig III system. Responses were amplified, digitally sampled at 100 kHz, and averaged over 50 discrete spectra. Fast Fourier transforms were computed from averaged responses. For each stimulus set, the DPOAE amplitude level at 2f1–f2 was extracted, and sound pressure levels for data points 100 Hz above and below the DPOAE frequency were averaged for the noise floor measurements. DPOAE levels were plotted as a function of primary tone GM frequency. Statistical analyses were performed using ANOVA with Bonferroni post-hoc tests and significance defined as p < 0.05. Data were collected from the transgenic (n=9), and WT (n=6) mice at P30.

Noise Induced Hearing Loss

8-week-old transgenic and WT mice were exposed awake and unrestrained within small cells in a subdivided stainless- steel mesh cage with constant rotation. Noise stimuli (4-20 kHz) were presented at 105 dB peak equivalent SPL for 30 minutes in order to generate a permanent threshold shift. Stimuli were generated by a personal computer connected to a waveform generator (Tucker DavisTechnologies, Alachua, FL), amplified and delivered through a speaker inside the noise booth. ABR threshold was measured prior to and after 72 hours and 26 days of noise exposure. Data were collected from the transgenic (n=6), and WT (n=6) mice.

α-Synuclein RNA Expression

Reverse Transcriptase-Polymerase Chain Reaction: The total RNA harvested from both the transgenic and WT mice cochleae extractions (Trizol™, Invitrogen Corp) was reverse transcribed with superscript II RNase H− (Invitrogen) for 50 min at 42°C, using oligodT primers. Two microliters of RT reaction product was used for subsequent polymerase chain reaction (PCR; Taq DNA Polymerase, Invitrogen) of 35 cycles using the following parameters: 94°C for 30 s, 60°C for 45 s, 72°C for 1 min, followed by a final extension of 72°C for 10 min and storage at 4°C. Primers were designed to amplify a unique sequence of mouse α-synucleins. The PCR primers that were used to amplify mouse α-synuclein (NM_009221) were: forward primer (1)-gtggagcaaaaatacatctttag and reverse primer (1) -gctgctcttccatggcgtaca primers that were designed to amplify a 505-bp fragment spanning exon 2 through the 5′ portion of exon 6 and Forward primer (2)gtggagcaaaaatacatctttag and reverse primer (2)-tgtacgccatggaagagcagc primers that were designed to amplify a 397-bp fragment spanning exon 2 through the 5′ portion of exon 5. Controls were cochlear RNA without reverse transcriptase. Analysis of each PCR sample was then performed on 2% agarose gels containing 0.5 μg/ml ethidium bromides. Gels were imaged using a digital Camera and image processing system (Kodak, Rochester NY, USA). Candidate bands were cut out and the DNA was extracted (Qiaquick gel extraction kit, Qiagen) and sequenced (Elim Biopharmaceuticals, Inc. Hayward, CA, USA). The PCR product was then compared directly to the full mouse α-Syn sequence for identity.

Quantitative PCR: For real-time, quantitative PCR, cochlea from the transgenic and WT mice was dissected. RNA was extracted and processed for RT as described above. The expression level of α-Syn was measured by the iQ5 real- time PCR (Bio-Rad, Hercules, CA, USA). Amplification was performed in a total volume of 25 μl containing 12.5 μl SYBR Green I amplification master mix (Bio-Rad), 250 nM primers of mouse α-synuclein (NM_009221). Forward- gtgacaaatgttggaggagc (100% identical to the human) and reverse -tggatcctggcagtgaggctt (90% identical to human) primers were designed to amplify a 186-bp fragment spanning exon 4 through the 5′ portion of exon 5, and ribosomal protein L19 (BC083131); and forward— atgtatcacagcctgtacctg, and reverse-ttcttggtctcttcctccttg primers were designed to amplify a 232-bp fragment, and 3 μl of 1:5 diluted cDNA as a template. The amplifications were performed in triplicate wells, using a program that consisted of initial denaturation at 95°C for 3 min followed by a 40-cycle of denaturation at 95°C for 10 s and annealing at 61°C for 30 s. After amplification, a melting curve was generated for every PCR product to check the specificity of the PCR reaction (absence of primer dimers or other nonspecific amplification product). The 2-ΔΔCT method was used to calculate relative fold difference in α-Syn RNA expression determined from real-time quantitative PCR experiments normalized to the ribosomal RNA L19, an internal control, relative to the expression level of α-Syn [34]. Statistical differences were calculated using a one-way ANOVA with Bonfferoni post hoc test with significance noted for p<0.05.

α-Synuclein Protein Expression

Immunofluorescence: Transgenic and WT mice littermates at P30 were anesthetized and their cochleae were isolated, dissected, perfused through the oval and round windows by 2% paraformaldehyde in 0.1M phosphate buffer (PB) at pH 7.4 and incubated in the same fixative for 2 hrs. After fixation, cochleae were rinsed with PB and immersed in 5% EDTA in 0.1M PB for decalcification. When cochleae were fully decalcified (~2 days), they were incubated overnight in 30% sucrose for cryoprotection. The cochleae then were embedded in O.C.T. Tissue Tek Compound (Miles Scientific). Specimens were cryosectioned parallel to the modiolus at 10-12 µm thickness for immunofluorescence, mounted on Superfrost™ microscope slides (Erie Scientific, Portsmouth NH) and stored at -20°C until use.

For immunofluorescent staining of the transgenic and WT cochlea sections, a monoclonal anti-α-synculein antibody against rat synuclein-1 (BD Biosciences cat no. 610786) that recognizes both human and endogenous mouse proteins, and a rabbit anti-neurofilament 200 (NF- 200; Chemicon, Temecula, CA, USA) antibody that labels afferent as well as some efferent auditory fibers [35], were used. After incubation at 37°C for 30 min, the sections were rinsed twice for 5 min in 0.1 M PBS pH 7.4, and then preincubated for 1 hr in the blocking buffer (0.3% Triton X100 and 30% normal goat serum). The sections were then incubated in a humid chamber overnight at 4°C with the mouse anti-α-synculein antibody at 1:300 and the rabbit anti-neurofilament 200 at 1:200 (diluted in the blocking buffer). Slides were then rinsed (2×10 min) and incubated for 2 hrs at room temperature (RT) with goat anti-mouse IgG antibody conjugated to Cy3 and goat anti-rabbit IgG antibody conjugated to Cy2 diluted to 1:2000. Following the removal of the secondary antibodies and prior to the final washes, the sections were exposed for 15 min at RT to the fluorescent dye 4, 6-diamidino-2-phenylindole (DAPI, 1.5μg/ml in PBS, Sigma) which allowed visualization of the nuclei along with immunofluorescence. The sections were then rinsed in PBS (2×10 min) and mounted in equal parts glycerol/PBS and cover slipped. The slides were observed with an Olympus microscope with confocal immunofluorescence. Cochlea Whole-Mount Immunofluorescence: Transgenic and WT mouse cochleae were perfused with 4% PFA in 0.1 M PB, pH 7.4, and remained in the fixative for 2 hrs at 4°C. Cochleae were washed with PB three times for 10 min and then decalcified with 5% EDTA in 0.1 M PBS for ~2 days. Following decalcification, the otic capsule was removed, followed by removal of the lateral wall, Reissner’s membrane, and the tectorial membrane. The remaining organ of Corti was incubated overnight at 4°C with the rabbit anti-myosin VIIa antibody (a hair-cell-specific marker; 1:50 dilution in PBS; Proteus Biosciences, catalog #25-6790). Whole-mount cochleae were rinsed twice for 10 min with PB and then incubated for 2hrs at RT with goat anti-rabbit IgG antibody conjugated to Cy2 (1:2000 dilutions in PB; Jackson ImmunoResearch, 111- 165-003). The whole mounts were rinsed with PB twice for 15 min and incubated with rhodamine–phalloidin (stock solution of 200 U/ml methanol, diluted 1:100 in PB for working solution (Invitrogen)) for 1 hr. Whole mounts were then rinsed with PB, further microdissected into individual turns for surface preparation, and then incubated for 15 min at RT with the fluorescent DAPI to mark nuclei. The cochlear whole mounts were rinsed in PB and mounted on glass slides in antifade FluorSave reagent (Calbiochem, 34589). Hair cells in the organ of Corti were visualized with an Olympus microscope with confocal immunofluorescence. Western Blot Analysis: Total protein extract was prepared from the transgenic and the WT mice cochlea using a lysis buffer containing (20 mM Tris HCl pH 7.5–8, 150 mM NaCl, 0.5% sodium deoxycolate, 1% Triton X100, 0.1 sodium dodecyl sulfate (SDS), 1 mM EDTA, 1 mM phenylmethylsulphonyl fluoride, and protease inhibitor cocktail). The cochlear homogenate was spun 10 min at 14,000 RPM at 4°C and the protein concentration in the supernatant was determined by Bradford assay. Approximately 100 μg of the supernatant was fractioned by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto nitrocellulose membrane. The blot membrane was incubated for 1 hr in blocking buffer containing 5% nonfat dry milk in PBS-T (phosphate buffer saline + 0.1% Tween 20) and then incubated overnight at 4°C with the monoclonal anti- α-synculein antibody (same antibody used for immunofluorescence) and with the rabbit anti-β-actin antibody diluted in 1% BSA in PBS-T. The blot was washed extensively 5 times with PBS-T and incubated with secondary IRDye fluorescent antibodies (Licor) (Alexa Fluor 680-conjugated anti-rabbit IgG (Molecular Probes) and IRDye800 conjugated anti-mouse IgG (Rockland, Gilbertsville, PA)). The membrane was exposed using the Odyssey Fc imaging system. α-synculein and β-actin signal intensities were analyzed by using the Odyssey infrared image system (LiCor) and quantified with Odyssey software.

Histology

Light Microscopy: Transgenic and WT mice littermates at P30 were anesthetized and their cochleae were isolated, dissected, perfused through the round and oval windows with a solution of 2.5% paraformaldehyde and 1.5% glutaraldehyde in 0.1 M phosphate buffered (PB) solution at pH 7.4, and then placed in the same fixative overnight at 4°C. The cochleae were rinsed with 0.1 M PB and post fixed in 1% osmium tetroxide for 2 hrs. Rinsed again and immersed in 5% EDTA for decalcification. The decalcified cochleae were then dehydrated in ethanol and propylene oxide and embedded in Araldite 502 resin (Electron Microscopy Sciences, Fort Washington, PA). Sections were cut at 5 µm thickness parallel to the cochlear modiolus. Finally, sections were stained with Toluidine Blue and mounted with Permount (Fisher Scientific, Houston, TX) on microscope slides and visualized with a Leica microscope. Electron Microscopy: The P30 transgenic and WT mice cochleae were surgically exposed, a stapedectomy was performed, and the round window perforated. Temporal bones were preserved by gentle in vivo perfusion of the fixative (2.5% paraformaldehyde and 1.5% glutaraldehyde buffered to pH 7.4 with 0.1M phosphate) through the perilymphatic channels, followed by post-fixation with a solution of 1% osmium tetroxide and 1.5% potassium ferricyanide phosphate buffered solution (potassium ferricyanide was used to improve contrast). The cochleae were decalcified, dehydrated, and then embedded in Epon. Thick sections (1μm) were mounted onto glass slides and counterstained with toluidine blue. Once the cochlear organ of Corti is observed, several ultrathin sections (silver to gray) were collected on Formvar films on slotted grids and stained with saturated aqueous 2% uranyl acetate and 0.4% lead citrate in 0.15N sodium hydroxide. The stained sections were then examined at 60 kV in a JEOL-JEM 100S transmission electron microscope.

α-Syn Expression in the Cochlea

α-Syn RNA Expression: Reverse-transcriptase (RT)-PCR was used to screen for the presence of α-Syn within the microdissected cochlea of the WT and transgenic (mutant) mice at P30. As shown in (Figure 1A), α-Syn mRNA is identified in the whole cochlear extracts for two different set of primers (1 and 2).

Click to enlarge

Figure 1: α-Syn mRNA in the WT and transgenic (mutant) cochlea: RT-PCR experiment was used to detect the presence of α-Syn mRNA in the WT and transgenic cochlea using two different set of primers 1 and 2 (Figure 1A). Controls lacking reverse-transcriptase (denoted with a ‘-‘) are included. The data demonstrate expression of α-Syn mRNA in the WT and transgenic cochlea (Figure 1A). Quantitative, real-time PCR was used to determine relative levels of α-Syn mRNA within the cochlea in the WT and the transgenic mice at P30, P8mo and P12mo. The expression levels were compared to the ribosomal protein L19 used as a house keeping gene. α-Syn mRNA shows ~3x amplification in the transgenic cochlea compared to WT at P30 (Figure 1B). α-Syn expression slightly decreased at P8mo (Figure 1C) then increase to reach ~5x amplification in the transgenic at P12mo (Figure 1D) when compared to the WT. Differences between the levels of α-Syn mRNA were statistically significant (n=5) for each sample, p<0.05.

Quantitative, real-time PCR (qPCR) was next used to assess the relative level of the α-Syn mRNA in the WT and transgenic cochlea at P30, P8mo and P12mo. The expression levels were compared to the ribosomal protein L19 used as a house keeping gene. α-Syn mRNA showed ~3x amplification in the transgenic cochlea compared to WT at P30 (Figure 1B). α-Syn expression slightly decreased at P8mo (Figure 1C) then increased to reach ~5x amplification in the transgenic at P12mo when compared to the WT (Figure 1D). Together these data suggest that α-Syn mRNA has significantly higher expression levels in transgenic mice cochlea compared to WT, documenting the correct α-Syn over-expression phenotype. Differences between the levels of α-Syn mRNA were statistically significant (n=5 for each sample, p<0.05). α-Syn Protein Expression: Anti-α-Syn antibody (red), which recognizes both human and mouse proteins, and anti-neurofilament 200 (NF200, green) were used for immunofluorescence within cochlear tissue (Figure 2). As expected, in the WT α-Syn localized predominantly to the base of the OHCs [23]. In contrast, in the transgenic mice α-Syn is additionally found throughout the inner and outer hair cells, as well as Deiters’ cells and inner phalangeal cells (Figure 2A). Western blot analysis was also performed to quantify α-Syn protein in the WT and the transgenic cochlea (Figures 2B & 2C). Similar to what was seen with immunofluorescence and qPCR, there was an increase of α-Syn protein in the transgenic cochlea as compared to the WT, but with a higher ratio of α-Syn protein expression than RNA expression at P30. In addition to providing further proof of the correct phenotype of the α-Syn over-expression mice, these data confirmed the specificity of the α-Syn antibody.

Click to enlarge

Figure 2: α-Syn protein expression in the WT and transgenic (mutant) mice cochlea: Immunofluorescence. was used to detect α-Syn and neurofilament protein expression using anti α-Syn antibody (Red) and anti-neurofilament 200 (NF200, green) antibodies (Figure 2A). The α-Syn protein localizes predominantly to the base of the cochlear OHCs and weak labeling to the base of the IHCs in WT. In transgenic mice over-expressing α-Syn, staining is seen in many cell types in the OC, including IHCs, OHCs, and Deiters’ cells (Figure 2A). This increase of the α-Syn protein in the transgenic was further demonstrated by western blot (Figure 2B) and quantified in Figure 2C relative to the protein β actin. OC: organ of Corti; DC Deiters’ cells; TC: Tunnel of Corti. OHC: outer hair cells; IHC: inner hair cells.

Effect of α-Syn Expression on Hearing: Auditory function in both WT and transgenic mice was tested to determine the effect of α-Syn over-expression on hearing.

Click to enlarge

Figure 3: Auditory function was tested in WT and transgenic (mutant) mice to determine the effect of α-syn over-expression on hearing function. Acoustic brainstem response (ABR) testing (Figure 3A) at P30 demonstrates a statistically significant increase of ABR threshold of about 15dB in transgenic mice for click and pure tones (8, 16 and 32 KHz) stimuli; Figure 3B shows the changes in hearing in the transgenic and WT mice over time as measured by click ABR at P1-10months. This demonstrates an elevated ABR threshold (~10-20 dB) in the transgenic vs. WT littermates that remains relatively stable until P4mo then progressively elevate in the transgenic as compared to WT mice to reach ~30dB at P10mo. Figure 3C demonstrates a significant decrease in ABR wave I amplitudes in the transgenic mice measured at two different intensity levels (80, and 90 dB SPL) when compared with the WT littermates. Figure 3D, ABR P2–P1 interpeak latencies showed a non-significant increase at P30 in the transgenic when compared to the WT mice. Distortion product otoacoustic emissions (DPOAE) at P30 (Figure 3E) showed no differences between the WT and the transgenic mice. DP means (DPOAEs) and NF means (Noise Floor). Comparison of click ABR and CAP thresholds in the WT (n=4) and transgenic (n=6) mice. Which demonstrated threshold elevation is maintained in CAP measurements but has a lower magnitude (~8dB difference between WT and transgenic) than the one observed for ABR (Figure F).

Auditory brainstem response (ABR) was used to test hearing in the WT and transgenic mice at P30 using broadband clicks and tone-burst stimuli (8, 16, and 32 kHz) at varying ages (P1mo- P10mo). At P30 (Figure 3A), ABR demonstrated a statistically significant elevation of ABR thresholds (average= 15dB) in transgenic mice for both click and pure tone-burst stimuli in the transgenic compared to WT mice. This ABR threshold elevation is relatively stable until P4mo (Figure 3B), after which the ABR threshold difference progressively increases to a 30dB difference by P10mo. At P30 there was a significant decrease in the ABR wave I amplitude of the transgenic vs WT mice for click stimuli when measured at either 80dB or 90dB (Figure 3C). To analyze whether the ABR threshold increase in the transgenic mice also had an effect on ABR wave morphology, the ABR interpeak latency between P1 and P2 was measured at P30. The transgenic mice demonstrated no significant P2-P1 delays for click stimuli (Figure 3D). While the precise cause of the decrease in ABR amplitude is not known, we initially postulated that it was a likely a consequence of either the inhibition of OHC contraction and/or a reduction of glutamate release by the IHC due to α-Syn over-expression. To test this, OHC and efferent neuronal function were measured using distortion product otoacoustic emissions (DPOAE) at P30 (Figure 3E). No significant differences were noted between the WT and the transgenic mice.

To identify more precisely the location of the defect identified in sound-evoked potentials in the transgenic mice, auditory nerve compound action potentials (CAP) were recorded at the round window and compared with ABR recordings in the WT and transgenic mice (Figure 3F). Under these conditions, the same differences were observed between the ABR threshold in the WT and the transgenic mice, approximately 15dB. This threshold elevation was also seen in CAP measurements, but with a smaller 8dB difference between WT and transgenic mice. Thus, while α-Syn over- expression clearly causes an ABR threshold elevation, it is unclear whether this results from changes in IHC glutamate release, changes in CNS synaptic function or a combination of these factors.

Effect of α-Syn Expression on Susceptibility to Noise: Because α-Syn protein is expressed in the base of the OHCs, we aimed to examine the effects on the efferent system by examining susceptibility to noise-induced hearing loss in the transgenic mice. To test this hypothesis, WT and transgenic mice were exposed to 105 dB, 4-20 kHz octave band noise for 30 minutes. The ABR thresholds were measured before and after 72 hrs and 26 days following the noise-exposure (Figures 4A & 4B). At 72 hrs, WT mice had a significant threshold shift of ~33dB (Figure 4C) which remained at 26 days post exposure. In contrast, in mice over-expressing α-Syn, there was only a ~7 dB threshold shift with click stimuli (Figure 4C). After 26 days (Figure 4B), the ABR threshold levels in WT mice showed a small recovery but remained elevated by 10-20dB compared to the transgenic mice, whose thresholds did not significantly change over this time period. These data suggest a protective effect of α-Syn over-expression against a permanent threshold shift after loud noise exposure. These findings are in line with other studies that have documented decreased susceptibility to noise trauma with increased activity of the efferent auditory pathway [36, 37, 38].

Click to enlarge

Figure 4: Changes in hearing threshold following noise exposure (105 dB, 4-20 kHz band, 30 minutes). Data are presented as mean ± SD. The threshold shift was statistically different in pre- vs post-noise exposure mice 72 hrs and 26 days following noise exposure for both WT and transgenic (mutant) mice (Figures 4A & 4B). However, WT mice showed a greater threshold shift (33dB) from baseline (before exposure) and when compared to transgenic mice after 72 hrs and 26 days post exposure (Figure 4C).

Effects of α-Synuclein Over-Expression on Hearing and Cochlear Morphology

α-Syn has been implicated in the pathogenesis of Parkinson’s Disease as well as other neurodegenerative disorders. While the precise mechanism underlying this association is unknown, it is thought to be mediated through an effect on synaptic transmission. Many patients with PD also have hearing loss. However, because PD occurs primarily in the elderly, a population in whom a majority has age-related hearing loss, distinguishing hearing loss from presbycusis versus that induced by pathologic changes due to PD is challenging. Despite this confounding influence, there are studies that document an increase in hearing loss in patients with PD [39, 40]. One recent study documented high frequency hearing loss with elevated speech recognition thresholds and impaired speech discrimination, which correlated with more advanced disease stages in PD patients as compared to age-matched controls [39]. With α-Syn’s presumed role in Ca2+ homeostasis and effects on voltage- dependent Ca2+ influx [21, 22], and its localization mainly to the OHC synapse Akil O. et al. [23], it is not surprising that abnormalities in α-Syn may have a detrimental effect in the auditory system as well. However, previous studies in a α-Syn knockout mouse at P21 failed to document any changes in auditory morphology or physiology [24]. Contemporary theories suggest α-Syn over-expression is linked to PD Singleton [25, 26, 27], due to inhibited neurotransmitter release [30] which in turn leads to pathological changes in the spinal and brainstem motoneurons [7, 29]. We thus sought to determine if α-Syn over-expression in a α-Syn over- expressing transgenic mouse model leads to any pathologic changes in auditory morphology or physiology. The results of these studies document that over-expression of α-Syn in the cochlea leads to a significant elevation of the ABR threshold and a decrease in wave I amplitude, but no discernable effect on DPOAEs, no loss of inner or outer hair cells, spiral ganglion neurons, or alterations in the morphology of the afferent IHC (ribbon) or efferent OHC synapses. Further, over-expression of α-Syn confers protection against a permanent threshold shift from noise exposure.

α-Syn Over-Expression Protects Against Noise- Induced Hearing Loss

The two major questions arising from these findings are: why does over-expression of a-syn lead to hearing loss, and why does this confer protection against a permanent threshold shift from noise? With regard to the hearing loss in the transgenic mice, a possible mechanism may be found in decreased neurotransmitter release at the afferent inner hair cell ribbon synapse, in a manner similar to that described in the CNS [30]. Reduction in neurotransmitter release should lead to an elevation of the ABR threshold and a decrease in wave I amplitude, which was seen in our model. Further, there was also a reduction in the compound action potentials in the transgenic mouse, which supports this concept. Loss of hair cells or abnormalities in synapse morphology does not account for these changes, since they were normal in the transgenic mice. To definitively pinpoint elevation of ABR thresholds at the level of the synapse, electrophysiologic studies would be required. However, such studies would not likely answer how α-Syn over-expression leads to a reduction in glutamate release, resulting in the changes seen.

These studies also demonstrated that α-Syn over- expression leads to protection against a permanent threshold shift from noise exposure. This occurred in the setting of normal OHC numbers, normal hair cell morphology, and normal DPOAE measures. It seems likely that changes in the efferent auditory pathway are responsible for this finding. Firstly, α-synuclein localizes to the efferent synapse [23].

Additionally, it has been shown by a number of investigators that the efferent system mediates protection against noise-induced hearing loss for review see Fuente A, et al. [41]. In particular, it has been documented that the strength of the efferent reflex mediated by the olivocochlear system is proportional to the susceptibility to noise-induced hearing loss [36, 37], while genetic alterations of this pathway can lead to increased protection against noise trauma [36, 38]. In our current model, over-expression of α-Syn also provides protection against a permanent threshold shift after noise exposure, suggesting that the efferent system and olivocochlear reflex are strengthened. Whether this is a central phenomenon, due to increased olivocochlear synaptic activity arising from the brainstem, or a peripheral response, due to decreased OHC function due to changes at the efferent synapse, is not known. At the cochlear level, α-Syn clearly localizes to the OHC synaptic region. In prior studies by Taranda J, et al. [38], a point mutation in the OHC nicotinic cholinergic receptor (nAChR) led to an increase in receptor conductance and enhanced noise protection. This implies that α-Syn over-expression in the OHC and at the synapse may increase the amount of acetylcholine release at the OHC synapse or alter the post-synpatic response of the OHC. Thus, to explain both findings, the reduction in hearing (ABR threshold elevation) and the enhanced noise protection, we suggest that α-Syn over-expression reduces the afferent response while enhancing the efferent response. Again, some clarity may be provided by the findings from Taranda J, et al. [38]. In that study ABR and DPOAE thresholds were elevated in ‘gain of function’ nAChR α9 knock-in transgenic mice. One tested and confirmed hypothesis in the Taranda J, et al. [38] study was that ongoing acetylcholine release produced a much stronger inhibitory effect, so acoustic thresholds were higher due to that enhanced inhibition. Thus, if α-Syn overexpression enhances efferent release of acetylcholine at the efferent synapse, this would have an effect similar to that seen with the nAChR α9 gain of function knock-in mouse, decreasing acoustic thresholds, with no obvious change in morphology. This also fits with the protection from acoustic trauma as seen in both the nAChR α9 gain of function knock- in mouse and the α-synuclein over-expression mice.

What is the Role of α-Synuclein in Inner Hair Cells and Supporting Cells?

There remains the question of the effect of α-Syn’s presence in inner hair cells and supporting cells in the over- expression transgenic mice. However, given that α-Syn is not normally functional in these cells, it is likely that α -Syn’s presence in these cells in the transgenic mice is similarly non-functional and does not affect IHC neurotransmitter release. This is supported by three pieces of evidence:

1. The IHC ribbon synapse differs in many ways from other neuronal synapses (e.g., different class of voltage-gated calcium channels, no synapsin, etc.);
2. α-Syn does not localize to IHCs in the WT mouse; and
3. In the α-Syn knockout mouse no functional deficit was seen [24].

Thus, all the changes seen in the α-Syn over- expression mice can be explained by increased efferent activity.

It should be noted that prior studies have also demonstrated that α-Syn over-expressing mice exhibit a number of abnormalities within the central nervous system, including pathological changes in the spinal and brainstem motoneurons [28, 29, 42, 43]. Thus, we cannot definitely rule out central pathology as a cause or contributor to the hearing changes observed in the transgenic mice. But the absence of pathological changes to the cochlear hair cells suggests that α-Syn over-expression affects the more the central auditory pathway than the cochlea. Future studies could potentially resolve the question of whether the abnormalities observed are peripherally vs. centrally mediated in this mouse model.